|
|
(41 intermediate revisions by 3 users not shown) |
Line 1: |
Line 1: |
| == QAing Conservation and Most Conserved tracks for a new assembly ==
| | This page is no longer maintained. |
| (using the ponAbe2 (orangutan) assembly as an example throughout)<BR>
| |
| | |
| === Make a list of tables: ===
| |
| * multiz8way
| |
| * multiz8wayFrames
| |
| * multiz8waySummary
| |
| * phastCons8way
| |
| * phastConsElements8way
| |
| * seq
| |
| * extFile
| |
| | |
| === Make a list of files to go to hgnfs1: ===
| |
| * /gbdb/ponAbe2/multiz8way/phastCons8way.wib
| |
| * /gbdb/ponAbe2/multiz8way/anno/maf/*
| |
| | |
| === Make a list of files to go to hgdownload: ===
| |
| * /usr/local/apache/htdocs/goldenPath/ponAbe2/phastCons8way/*.*
| |
| * /usr/local/apache/htdocs/goldenPath/ponAbe2/phastCons8way/phastConsScores/*
| |
| * /usr/local/apache/htdocs/goldenPath/ponAbe2/multiz8way/*.*
| |
| * /usr/local/apache/htdocs/goldenPath/ponAbe2/multiz8way/maf/*
| |
| | |
| === Make a list of all organisms in the Conservation track: ===
| |
| {|
| |
| | orangutan || Pan troglodytes || July 2007 || ponAbe2
| |
| |-
| |
| | human || Homo sapiens || Mar 2006 || hg18
| |
| |-
| |
| | chimpanzee || Pan troglodytes || Mar 2006 || panTro2
| |
| |-
| |
| | rhesus || Macaca mulatta || Jan 2006 || rheMac2
| |
| |-
| |
| | marmoset || Callithrix jacchus || June 2007 || calJac1
| |
| |-
| |
| | mouse || Mus musculus || July 2007 || mm9
| |
| |-
| |
| | opossum || Monodelphis domestica || Jan 2006 || monDom4
| |
| |-
| |
| | platypus || Ornithorhychus anatinus || Mar 2007 || ornAna1
| |
| |}
| |
| | |
| === Make a list of all organisms for which there are nets & chains: ===
| |
| (put in order of furthest from this species to closest)<BR>
| |
| * ornAna1
| |
| * monDom4
| |
| * mm9
| |
| * rheMac2
| |
| * panTro2
| |
| * hg18
| |
| | |
| | |
| === Check the following in the files: ===
| |
| ==== Check annotated maf files for overlapping blocks: ====
| |
| *Note that upstream*.maf files do not need to be checked in this way.
| |
| [hgwdev:/gbdb/ponAbe2/multiz8way/anno/maf>
| |
| foreach f (*.maf)
| |
| echo -n "${f}: "
| |
| mafFilter -overlap -minRow=1 $f > /dev/null
| |
| end
| |
| | |
| ''If there are 'rejected blocks', contact the developer.''
| |
| | |
| | |
| ==== Read both README files: ====
| |
| /goldenPath/ponAbe2/phastCons8way/README.txt<BR>
| |
| /goldenPath/ponAbe2/multiz8way/README.txt
| |
| | |
| ==== Check upstream files to make sure that the species name doesn't appear in an "s" line: ====
| |
| [hgwdev:~/goldenPath/ponAbe2/multiz8way/maf> zcat upstream*.maf.gz | grep "s ponAbe2" | wc -l<BR>
| |
| 0<BR>
| |
| ''If this is not zero, contact the developer.''
| |
| | |
| ==== Check upstream files to make sure gene names haven't been truncated (to 9 chars): ====
| |
| [hgwdev:~/goldenPath/ponAbe2/multiz8way/maf> zcat upstream*.maf.gz | head
| |
| ##maf version=1 scoring=zero
| |
| a score=0.000000
| |
| s NM_001017434 0 1000 + 1000 GTGAAGTGTCAGGGTGGAGAAGCAAATACAAACTCTTCACTAAGTGGCCCT
| |
| ''If the gene names are short (9 characters) contact the developer.''
| |
| | |
| To generate a list of gene names and pipe to a file called "test":
| |
| zcat upstream1000.maf.gz | grep "NM_.*" | cut -f2 -d" " > test
| |
| | |
| To see how many file names are 10 or more characters long:
| |
| grep "[0-9]\{10,\}" test
| |
| | |
| ==== Check one maf file: ====
| |
| [hgwdev:~/goldenPath/ponAbe2/multiz8way/maf> zcat chrX.maf.gz | head
| |
| ##maf version=1 scoring=autoMZ.v1
| |
| a score=21236.000000
| |
| s ponAbe2.chrX 2 249 + 156195299 cagtggcatgatcacagatgactgcagcctcggcctccatagc
| |
| | |
| ==== Read through both description pages: ====
| |
| * Conservation track:
| |
| ** Check image that displays on conservation details page.
| |
| ** Check "Gene tracks used for codon translation" table against make doc.
| |
| ** Make sure organisms are listed (in all places) in the correct phylogenetic order.
| |
| ** Make sure that this page includes all the extra sections (if the multizs have been annotated).
| |
| ** Make sure there is a tree model available.
| |
| * Most Conserved track:
| |
| ** Make sure the text refers to the correct species.
| |
| | |
| ==== Check trackDb.ra file: ====
| |
| * Conservation track:
| |
| ** Make sure there is a speciesCodonDefault entry (usually is this species).
| |
| ** Make sure Jim has signed off on the species listed in the speciesDefaultOff entry.
| |
| * Most Conserved track:
| |
| | |
| | |
| | |
| === Figure out extFile and seq tables: ===
| |
| * if they are standard maf files, there will be no entries in the seq table.
| |
| * There may be more than one set of entries in the extFile table. Make sure you only push the set that pertains to the actual files you are pushing to hgnfs1 (e.g. /gbdb/ponAbe2/multiz8way/anno/maf/*)
| |
| * These are the ones that will need pushing to beta:
| |
| mysql> select path from extFile where path like "%anno/maf%";
| |
| | |
| | |
| === Test in the Genome Browser: ===
| |
| * Zoom out past 1M bps (this tests the multiz*waySummary table)
| |
| * Find example areas of all annotation types (check against the maf file for that location):
| |
| ** pale yellow bar
| |
| ** green square brackets
| |
| ** vertical blue bar
| |
| ** gaps
| |
| * Check out codon translation for a few species.
| |
| | |
| | |
| === Test in the tables: ===
| |
| * joinerCheck
| |
| | |
| * featureBits
| |
| [hgwdev:~/qa/tracks/conservation/ponAbe2> nice featureBits ponAbe2 multiz8way gap -bed=output.bed
| |
| 162920397 bases of 3093572278 (5.266%) in intersection
| |
| | |
| * countPerChrom.csh ponAbe2 multiz8way
| |
| | |
| * find out how phastCons was run (from make doc). See if the species listed in the non-inf list make sense. In this case, they do not add to the phastCons wiggle. --not-informative
| |
| | |
| [[Category:Browser QA]]
| |