Programmatic access to the Genome Browser: Difference between revisions

From genomewiki
Jump to navigationJump to search
Line 60: Line 60:
== Get a copy of the current Genome Browser image from a script ==
== Get a copy of the current Genome Browser image from a script ==
*  use <code>curl http://genome.ucsc.edu/cgi-bin/hgRenderTracks > test.png</code>. hgRenderTracks understands the same parameters and options as the main hgTracks CGI, e.g. <internalTrackName>=pack
*  use <code>curl http://genome.ucsc.edu/cgi-bin/hgRenderTracks > test.png</code>. hgRenderTracks understands the same parameters and options as the main hgTracks CGI, e.g. <internalTrackName>=pack
* to get the internal track name of a track, mouse over the track and look at your internet browser status line or go to the track configuration page and look for the value of the variable called "g" in the current URL  
* to get the internal track name of a track, mouse over the track and look at your internet browser status line or go to the track configuration page and look for the value of the variable called "g" in the current URL. You can also use the trackDb table to get a list of all tracks and their names (see above).
* to hide the default track when you use hgRenderTracks, make sure that the first track parameter is hideTracks=1
* to hide the default track when you use hgRenderTracks, make sure that the first track parameter is hideTracks=1
* for example, to download the image for a chromosomal location with only the RefSeq transcripts and publications track to "pack" mode, use this command:  <code>curl 'http://genome.ucsc.edu/cgi-bin/hgRenderTracks?position=chr17:41570860-41650551&hideTracks=1&refGene=pack&pubs=pack' > temp.png</code>
* for example, to download the image for a chromosomal location with only the RefSeq transcripts and publications track to "pack" mode, use this command:  <code>curl 'http://genome.ucsc.edu/cgi-bin/hgRenderTracks?position=chr17:41570860-41650551&hideTracks=1&refGene=pack&pubs=pack' > temp.png</code>

Revision as of 13:39, 6 July 2015

The UCSC API for retrieving data and uploading data is RESTful over HTTP but does not use JSON to save computational time on the server. Download of most data formats requires client-side C tools that convert to/from binary files. Data upload uses custom text files.

Here are some common tasks that can be done from scripts with the UCSC Genome Browser. It is assumed that the reader knows the standard Unix command line tools.

Download data stored in a database table

  • use Tools - Table Browser - "Describe schema" to browse the database schema. All fields have a human readable description and the links to other tables are shown.
  • to access the public Mysql server, use a commen like mysql hg19 --no-defaults -h genome-mysql.cse.ucsc.edu -u genome -A -e 'select * from pubsBingBlat' -NB > out.txt
  • the list of data tracks is part of the table trackDb. The first column is the internal name of the track.
  • note the "type" field in the table trackDb. Our documentation of file formats at http://genome.ucsc.edu/FAQ/FAQformat.html explains the meaning of the columns in these tables.
  • tracks with types that start with "big" are stored in binary files (see below) and require special client programs to extract, all others are stored at least to some extent in Mysql tables.
  • the first column in many tables with genomic coordinates is called "bin" and can be stripped for most applications
 mysql --no-defaults -h genome-mysql.cse.ucsc.edu -u genome -A -e "select ta
bleName, type, priority from trackDb where tableName in ('gold', 'refGene','knownGene', 'ccds', 'clinvar') limit 5"  hg19 
+-----------+-------------------------------------+----------+
| tableName | type                                | priority |
+-----------+-------------------------------------+----------+
| clinvar   | bigBed 12 .                         |      100 |
| gold      | bed 3 +                             |      100 |
| knownGene | genePred knownGenePep knownGeneMrna |        1 |
| refGene   | genePred refPep refMrna             |        2 |
+-----------+-------------------------------------+----------+

mysql --no-defaults -h genome-mysql.cse.ucsc.edu -u genome -A -e "select * from knownGene limit 3"  hg19 
+------------+-------+--------+---------+-------+----------+--------+-----------+--------------------+--------------------+-----------+------------+
| name       | chrom | strand | txStart | txEnd | cdsStart | cdsEnd | exonCount | exonStarts         | exonEnds           | proteinID | alignID    |
+------------+-------+--------+---------+-------+----------+--------+-----------+--------------------+--------------------+-----------+------------+
| uc001aaa.3 | chr1  | +      |   11873 | 14409 |    11873 |  11873 |         3 | 11873,12612,13220, | 12227,12721,14409, |           | uc001aaa.3 |
| uc010nxr.1 | chr1  | +      |   11873 | 14409 |    11873 |  11873 |         3 | 11873,12645,13220, | 12227,12697,14409, |           | uc010nxr.1 |
| uc010nxq.1 | chr1  | +      |   11873 | 14409 |    12189 |  13639 |         3 | 11873,12594,13402, | 12227,12721,14409, | B7ZGX9    | uc010nxq.1 |
+------------+-------+--------+---------+-------+----------+--------+-----------+--------------------+--------------------+-----------+------------+

Get the chromosome sequence for a range

twoBitToFa http://hgdownload.cse.ucsc.edu/gbdb/hg19/hg19.2bit stdout -seq=chr21 -start=15000000 -end=15000050
>chr21:15000000-15000050  
agccctgaacaaagacagggcttggcttatataggcaaacttacagaagc

Get the "wiggle" (x-y-plot) graph data for a chromosome range

bigWigToWig http://hgdownload.cse.ucsc.edu/gbdb/hg19/bbi/wgEncodeBroadHistoneK562Cbx2Sig.bigWig -chrom=chr21 -start=15000000 -end=15000200 stdout
variableStep chrom=chr21 span=25
15000026        0.92
15000051        1
15000076        1
15000101        1
15000126        1
15000151        1.24
15000176        2

Get a copy of the current Genome Browser image from a script

  • use curl http://genome.ucsc.edu/cgi-bin/hgRenderTracks > test.png. hgRenderTracks understands the same parameters and options as the main hgTracks CGI, e.g. <internalTrackName>=pack
  • to get the internal track name of a track, mouse over the track and look at your internet browser status line or go to the track configuration page and look for the value of the variable called "g" in the current URL. You can also use the trackDb table to get a list of all tracks and their names (see above).
  • to hide the default track when you use hgRenderTracks, make sure that the first track parameter is hideTracks=1
  • for example, to download the image for a chromosomal location with only the RefSeq transcripts and publications track to "pack" mode, use this command: curl 'http://genome.ucsc.edu/cgi-bin/hgRenderTracks?position=chr17:41570860-41650551&hideTracks=1&refGene=pack&pubs=pack' > temp.png

Upload a custom track and link to the genome browser with the track loaded