SECIS comparative genomics: Difference between revisions
Tomemerald (talk | contribs) |
m (fixup absolute URL references) |
||
(12 intermediate revisions by one other user not shown) | |||
Line 3: | Line 3: | ||
<embedurl> | <embedurl> | ||
http://hgwdev.cse.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=Tomemerald&hgS_otherUserSessionName=DIO1 | http://hgwdev.cse.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=Tomemerald&hgS_otherUserSessionName=DIO1 | ||
{scrolling=auto}{width= | {scrolling=auto}{width=1250}{height=500} | ||
</embedurl> | </embedurl> | ||
=== Embedded browser2 === | === Embedded browser2 === | ||
<embedurl> | <embedurl> | ||
http://hgwdev.cse.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=Tomemerald&hgS_otherUserSessionName= | http://hgwdev.cse.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=Tomemerald&hgS_otherUserSessionName=boreoSECIS | ||
{scrolling=auto}{width= | {scrolling=auto}{width=1250}{height=300} | ||
</embedurl> | </embedurl> | ||
=== Embedded | === Embedded SECIS frame navigator: work in progress === | ||
< | <table border cellpadding="2"> | ||
http:// | <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr1:54149214-54149304&pix=900&Submit=submit&hgsid=108664512 +DIO1]</tr> | ||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr14:79733861-79733960&pix=900&Submit=submit&hgsid=108664512 -DIO2]</tr> | |||
</ | <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr14:101099071-101099164&pix=900&Submit=submit&hgsid=108664512 +DIO3]</tr> | ||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr3:49369691-49369785&pix=900&Submit=submit&hgsid=108664512 -GPX1]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr14:64475664-64475758&pix=900&Submit=submit&hgsid=108664512 -GPX2]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr5:150388518-150388612&pix=900&Submit=submit&hgsid=108664512 +GPX3]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr19:1057606-1057699&pix=900&Submit=submit&hgsid=108664512 +GPX4]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr6:28579354-28579447&pix=900&Submit=submit&hgsid=108664512 -GPX6]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr16:1928560-1928655&pix=900&Submit=submit&hgsid=108664512 -MSRB1]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr11:57266912-57266997&pix=900&Submit=submit&hgsid=108664512 +SELH]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr2:26466729-26466827&pix=900&Submit=submit&hgsid=108664512 +SELI]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr3:53894412-53894514&pix=900&Submit=submit&hgsid=108664512 -SELK]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr1:87101071-87101170&pix=900&Submit=submit&hgsid=108664512 -SELM1]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr22:48998024-48998125&pix=900&Submit=submit&hgsid=108664512 +SELO]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr15:99630065-99630164&pix=900&Submit=submit&hgsid=108664512 -SELS]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr3:151828145-151828239&pix=900&Submit=submit&hgsid=108664512 +SELT]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr19:44702609-44702705&pix=900&Submit=submit&hgsid=108664512 +SELV]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr16:30362559-30362656&pix=900&Submit=submit&hgsid=108664512 -SEPHS2]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr1:26015877-26015962&pix=900&Submit=submit&hgsid=108664512 +SEPN]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr5:42836241-42836339&pix=900&Submit=submit&hgsid=108664512 -SEPP1a]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr19:52979371-52979466&pix=900&Submit=submit&hgsid=108664512 +SEPW]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr12:103266545-103266640&pix=900&Submit=submit&hgsid=108664512 +TXNRD1]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr22:18243070-18243167&pix=900&Submit=submit&hgsid=108664512 -TXNRD2]</tr> | |||
<tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr3:127809148-127809242&pix=900&Submit=submit&hgsid=108664512 -TXNRD3]</tr> | |||
</table> | |||
== Underlying data for the SECIS track == | == Underlying data for the SECIS track == | ||
Line 561: | Line 578: | ||
</pre> | </pre> | ||
=== | === PSL data that generate SECIS custom track === | ||
<pre> | <pre> | ||
35 0 0 0 0 0 0 0 + DIO1_left 35 0 35 chr1 247249719 54149213 54149248 1 35, 0, 54149213, | 35 0 0 0 0 0 0 0 + DIO1_left 35 0 35 chr1 247249719 54149213 54149248 1 35, 0, 54149213, | ||
Line 782: | Line 799: | ||
21 1 0 0 0 0 0 0 - GPX1_alex 44 0 22 chrX 154913754 74223907 74223929 1 22, 22, 74223907, | 21 1 0 0 0 0 0 0 - GPX1_alex 44 0 22 chrX 154913754 74223907 74223929 1 22, 22, 74223907, | ||
21 1 0 0 0 0 0 0 - SEPN_alex 42 0 22 chrX 154913754 74223907 74223929 1 22, 20, 74223907, | 21 1 0 0 0 0 0 0 - SEPN_alex 42 0 22 chrX 154913754 74223907 74223929 1 22, 20, 74223907, | ||
</pre> | |||
=== PSL data that generate boreoeutherian custom track === | |||
<pre> | |||
84 7 0 0 0 0 0 0 + DIO1_tool1 91 0 91 chr1 169519511 40171838 40171929 1 91, 0, 40171838, | |||
92 4 0 0 0 0 0 0 - DIO2_tool1 100 4 100 chr14 126455928 105764192 105764288 1 96, 0, 105764192, | |||
88 6 0 0 0 0 0 0 + DIO3_tool1 94 0 94 chr14 126455928 123303991 123304085 1 94, 0, 123303991, | |||
87 5 0 0 0 0 0 0 - GPX2_tool1 95 0 92 chr14 126455928 93515719 93515811 1 92, 3, 93515719, | |||
85 4 0 0 0 0 0 0 + GPX3_tool1 95 6 95 chr5 135438014 111596045 111596134 1 89, 6, 111596045, | |||
85 7 0 0 0 0 3 6 + GPX4_tool1 94 2 94 chr19 11836958 494587 494685 4 21,31,35,5, 2,23,54,89, 494587,494609,494644,494680, | |||
88 6 0 0 0 0 0 0 - GPX6_tool1 94 0 94 chr6 128772084 22570259 22570353 1 94, 0, 22570259, | |||
68 4 0 0 0 0 0 0 - MSRB1_tool1 96 22 94 chr16a 21784349 1375915 1375987 1 72, 2, 1375915, | |||
74 5 0 0 0 0 0 0 + SELH_tool1 86 4 83 chr11 100778330 88371632 88371711 1 79, 4, 88371632, | |||
95 4 0 0 0 0 0 0 + SELI_tool1 99 0 99 chr2a 83993180 21144892 21144991 1 99, 0, 21144892, | |||
91 4 0 0 1 5 1 1 - SELM1_tool1 100 0 100 chr1 169519511 66580051 66580147 2 17,78, 0,22, 66580051,66580069, | |||
91 4 0 0 1 5 1 1 + SELM1_tool1 100 0 100 chr14 126455928 95588814 95588910 2 78,17, 0,83, 95588814,95588893, | |||
70 3 0 0 0 0 0 0 + SELO_tool1 102 20 93 chr12a 94328666 93913600 93913673 1 73, 20, 93913600, | |||
98 2 0 0 0 0 0 0 + SELS_tool1 100 0 100 chr14 126455928 6005591 6005691 1 100, 0, 6005591, | |||
90 7 0 0 0 0 0 0 - SELS_tool1 100 0 97 chr14 126455928 3441919 3442016 1 97, 3, 3441919, | |||
95 0 0 0 0 0 1 93 - SELT_tool1 95 0 95 chr3 176510875 97714857 97715045 2 90,5, 0,90, 97714857,97715040, | |||
88 2 0 0 0 0 0 0 + SELT_tool1 95 5 95 chr9 83807521 22270311 22270401 1 90, 5, 22270311, | |||
86 4 0 0 0 0 0 0 + SELV_tool1 97 7 97 chr16b 53486001 42050779 42050869 1 90, 7, 42050779, | |||
94 4 0 0 0 0 0 0 + SEPHS2_tool1 98 0 98 chr5 135438014 12044148 12044246 1 98, 0, 12044148, | |||
93 5 0 0 0 0 0 0 - SEPHS2_tool1 98 0 98 chr16a 21784349 21020047 21020145 1 98, 0, 21020047, | |||
83 3 0 0 0 0 0 0 + SEPHS2_tool1 98 12 98 chr14 126455928 24823440 24823526 1 86, 12, 24823440, | |||
79 6 0 0 1 1 1 2 + SEPN_tool1 86 0 86 chr1 169519511 18769015 18769102 2 13,72, 0,14, 18769015,18769030, | |||
93 6 0 0 0 0 0 0 - SEPP1a_tool1 99 0 99 chr5 135438014 32424675 32424774 1 99, 0, 32424675, | |||
78 6 0 0 0 0 0 0 - SEPP1b_tool1 89 5 89 chr5 135438014 32424222 32424306 1 84, 0, 32424222, | |||
74 6 0 0 0 0 0 0 + SEPW_tool1 96 0 80 chr16b 53486001 46899188 46899268 1 80, 0, 46899188, | |||
90 6 0 0 0 0 0 0 + TXNRD1_tool1 96 0 96 chr12a 94328666 77277518 77277614 1 96, 0, 77277518, | |||
72 7 0 0 1 10 1 11 + TXNRD2_tool1 98 3 92 chr12b 28829889 27296171 27296261 2 60,19, 3,73, 27296171,27296242, | |||
77 12 0 0 0 0 1 1 + TXNRD3_tool1 95 0 89 chr3 176510875 176010292 176010382 2 83,6, 0,83, 176010292,176010376, | |||
</pre> | </pre> | ||
Line 790: | Line 838: | ||
Five kinds of Blat sequences marker are used to make this track. The first is simply downstream non-coding mRNA, which provides a visual context of the entire region when the browser is opened to that width. The next three markers (defined by spaces in SECISearch tool output) denote the start up to the ATGAA portion of the kink-turn, up to AA in the apical loop, and up the complementary AGAT of the kink-turn stem. The final blat marker shows output of the new Cove tool. | Five kinds of Blat sequences marker are used to make this track. The first is simply downstream non-coding mRNA, which provides a visual context of the entire region when the browser is opened to that width. The next three markers (defined by spaces in SECISearch tool output) denote the start up to the ATGAA portion of the kink-turn, up to AA in the apical loop, and up the complementary AGAT of the kink-turn stem. The final blat marker shows output of the new Cove tool. | ||
Overall, this custom track allows quick visual comparisons of the three main prediction schemes for the SECIS insertion element. The track synergizes with the collection and comparative genomics analysis of selenoproteins and their insertion elements at the [ | Overall, this custom track allows quick visual comparisons of the three main prediction schemes for the SECIS insertion element. The track synergizes with the collection and comparative genomics analysis of selenoproteins and their insertion elements at the [[Selenoprotein_evolution:_update_blog|UCSC genomeWiki project.]] The track configuration specified at the wiki for interactive multi-display displays actual basepair differences to be seen relative to human on all but the longest mRNA blat track | ||
Methods for generating the data are discussed [ | Methods for generating the data are discussed within the [[Selenoprotein_evolution:_SECIS|selenoprotein comparative genomics page]]. Briefly, fully validated human representatives and placental mammal orthologous counterparts are collected and parsed with the SECIS tools to generate appropriate Blat queries. The 25 queries for each gene saturate the allowed query complexity at Blat so the psl-formatted output of 5 separate queries must be concatenated to create the input to the custom track. | ||
The SECIS elements are validated by 6 methods: the correct position in 3' UTR, correct positive strand, occurence over a phastCons peak in the 28-species alignment, recognition by the two SECIS web tools that use the rnaFold algorithm, and agreement with experimental results for individual genesat PubMed when available.. | The SECIS elements are validated by 6 methods: the correct position in 3' UTR, correct positive strand, occurence over a phastCons peak in the 28-species alignment, recognition by the two SECIS web tools that use the rnaFold algorithm, and agreement with experimental results for individual genesat PubMed when available.. | ||
Credits for the thousands of individuals involved in producing the underlying data for UCSC browser, each of the tracks used here, and the genomeWiki infrastructure are provided on [http://genome-test.cse.ucsc.edu/goldenPath/credits.html that site.]. Individual contributions to the selenoprotein pages including this custom track in the community-collaborative genomeWiki are specified at its [ | Credits for the thousands of individuals involved in producing the underlying data for UCSC browser, each of the tracks used here, and the genomeWiki infrastructure are provided on [http://genome-test.cse.ucsc.edu/goldenPath/credits.html that site.]. Individual contributions to the selenoprotein pages including this custom track in the community-collaborative genomeWiki are specified at its [[Selenoprotein_evolution:_update_blog|update blog.]] | ||
References: | References: |
Latest revision as of 00:51, 15 January 2009
Embedded active browsers displaying SECIS elements
Embedded browser1
<embedurl> http://hgwdev.cse.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=Tomemerald&hgS_otherUserSessionName=DIO1 {scrolling=auto}{width=1250}{height=500} </embedurl>
Embedded browser2
<embedurl> http://hgwdev.cse.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=Tomemerald&hgS_otherUserSessionName=boreoSECIS {scrolling=auto}{width=1250}{height=300} </embedurl>
+DIO1 |
-DIO2 |
+DIO3 |
-GPX1 |
-GPX2 |
+GPX3 |
+GPX4 |
-GPX6 |
-MSRB1 |
+SELH |
+SELI |
-SELK |
-SELM1 |
+SELO |
-SELS |
+SELT |
+SELV |
-SEPHS2 |
+SEPN |
-SEPP1a |
+SEPW |
+TXNRD1 |
-TXNRD2 |
-TXNRD3 |
Underlying data for the SECIS track
Blat queries by block for custom SECIS track
>SEPP1a_left ttttctttttccagtgttctatttgctttaatgag >SEPP1b_left tatattgcttagtaagtatttccatagtcaatgat >SEPN_left cagtggcttccccggcagcagccccatgat >SEPHS2_left acctgcaaccatctgacttggtctctgttaatgac >SELM1_left agagtgaaacattcacaaagatttgcgttaatgaa >MSRB1_left cctgccagccgccctggccctggtcactgcatgat >TXNRD1_left atttggcagggcatcgaagggatgcatccatgaa >TXNRD3_left gacagcgagaagcagtgggactgcttccttgac >TXNRD2_left cacccccccccaggctcctggtgccagatgatgac >SELS_left taggacagtctctgtgacaggttgcgttgaatgat >SELT_left gatcattgcaagagcagcgtgactgacattatgaa >SELO_left ctgccctggcccatgcacacccgtctttccatgat >SELV_left tttctctcccatcttaggagtctcagctggatgat >SELH_left tttgtgtccctggtgatgttggaacattaatgat >SELI_left tttcactgaatgaagtttgtgcttgaatgaa >SELK_left acaaggactgctctgtgtcctcacagatgaatgag >GPX3_left cacggaccccatggcaggggtggcgtcttcatgag >GPX6_left cccacctcacatgaagggaagggcatctccatgat >GPX1_left tgctgtctcgggggggttttcatctatgag >GPX2_left agacttgggtaagctctgggccttcacagaatgat >GPX4_left ccacgcccttggagccttccaccggcactcatgac >SEPW_left gacccagcccctctcagcagacgcttcatgat >DIO1_left ttttaactctgtgtctttacatatttgtttatgat >DIO2_left cagagatgtgcagagttgaccagtgtgcggatgat >DIO3_left ttgggtgcacaggagccccactgctgatgac >SEPP1a_mid ttttctttttccagtgttctatttgctttaatgagaatagaaacgtaa >SEPP1b_mid tatattgcttagtaagtatttccatagtcaatgatggtttaataggtaa >SEPN_mid cagtggcttccccggcagcagccccatgatggctgaatccgaa >SEPHS2_mid acctgcaaccatctgacttggtctctgttaatgacgtctctccctctaa >SELM1_mid agagtgaaacattcacaaagatttgcgttaatgaagactacacagaaa >MSRB1_mid cctgccagccgccctggccctggtcactgcatgatccgctctggtcaa >TXNRD1_mid atttggcagggcatcgaagggatgcatccatgaagtcaccagtctcaa >TXNRD3_mid gacagcgagaagcagtgggactgcttccttgacgccttagcttgg >TXNRD2_mid cacccccccccaggctcctggtgccagatgatgacgacctgggtggaa >SELS_mid taggacagtctctgtgacaggttgcgttgaatgatgtcttccttatcaa >SELT_mid gatcattgcaagagcagcgtgactgacattatgaaggcctgtactgaa >SELO_mid ctgccctggcccatgcacacccgtctttccatgatggcagagacatcc >SELV_mid tttctctcccatcttaggagtctcagctggatgatgagaagggctgaa >SELH_mid tttgtgtccctggtgatgttggaacattaatgatggaacatggccaa >SELI_mid tttcactgaatgaagtttgtgcttgaatgaagagtgtatcttaaa >SELK_mid acaaggactgctctgtgtcctcacagatgaatgaggtcatgctgggaa >GPX3_mid cacggaccccatggcaggggtggcgtcttcatgagggaggggcccaaa >GPX6_mid cccacctcacatgaagggaagggcatctccatgatggtggatcccaa >GPX1_mid tgctgtctcgggggggttttcatctatgagggtgtttcctctaa >GPX2_mid agacttgggtaagctctgggccttcacagaatgatggcaccttcctaa >GPX4_mid ccacgcccttggagccttccaccggcactcatgacggcctgcctgca >SEPW_mid gacccagcccctctcagcagacgcttcatgataggaaggactgaa >DIO1_mid ttttaactctgtgtctttacatatttgtttatgatggccacagcctaa >DIO2_mid cagagatgtgcagagttgaccagtgtgcggatgataactactgacgaa >DIO3_mid ttgggtgcacaggagccccactgctgatgacgaactatctctaa >SEPP1a_tool1 ttttctttttccagtgttctatttgctttaatgagaatagaaacgtaaactatgacctaggggtttctgttggataattagcagtttagaatggaggaa >SEPP1b_tool1 tatattgcttagtaagtatttccatagtcaatgatggtttaataggtaaaccaaaccctataaacctgacctcctttatggttaatact >SEPN_tool1 cagtggcttccccggcagcagccccatgatggctgaatccgaaatcctcgatgggtccagcttgatgtctttgcagctgcacctat >SEPHS2_tool1 acctgcaaccatctgacttggtctctgttaatgacgtctctccctctaaaccccattaaggactgggagaggcagagcaagcctcagagcccaggcct >SELM1_tool1 agagtgaaacattcacaaagatttgcgttaatgaagactacacagaaaacctttctagggatttgtgtggatcagatacatacttggcaaatttttgagt >MSRB1_tool1 cctgccagccgccctggccctggtcactgcatgatccgctctggtcaaacccttccaggccagccagagtggggatggtctgtgacctgctgggaa >TXNRD1_tool1 atttggcagggcatcgaagggatgcatccatgaagtcaccagtctcaagcccatgtggtaggcggtgatggaacaactgtcaaatcagttttagca >TXNRD3_tool1 gacagcgagaagcagtgggactgcttccttgacgccttagcttggagccccgttatgaggtgagccaaggctgactctcgcaagccaggactgag >TXNRD2_tool1 cacccccccccaggctcctggtgccagatgatgacgacctgggtggaaacctaccctgtgggcacccatgtccgagccccctggcatttctgcaatgc >SELS_tool1 taggacagtctctgtgacaggttgcgttgaatgatgtcttccttatcaatggtgagcccaccagtgaggattactgatgtggacagttgatggggtttgt >SELT_tool1 gatcattgcaagagcagcgtgactgacattatgaaggcctgtactgaagacagcaagctgttagtacagaccagatgctttcttggcaggctcgt >SELO_tool1 ctgccctggcccatgcacacccgtctttccatgatggcagagacatccagtcaggacctgacccgtctctgtctgaggccggctcagcagtgcagcctggtc >SELV_tool1 tttctctcccatcttaggagtctcagctggatgatgagaagggctgaaatgttgccaagtcaggtccttttctgatggtggctggggctggggtgag >SELH_tool1 tttgtgtccctggtgatgttggaacattaatgatggaacatggccaaacttcagtcatgatcctgaagccatggtttcttccctgc >SELI_tool1 tttcactgaatgaagtttgtgcttgaatgaagagtgtatcttaaaccccctttttttggacaggctgcacttggataaaataggcaccactgtgttgat >SELK_tool1 acaaggactgctctgtgtcctcacagatgaatgaggtcatgctgggaattccctctgcagggaactggcctgactgacatgcagttccataaatgcagatgtt >GPX3_tool1 cacggaccccatggcaggggtggcgtcttcatgagggaggggcccaaagcccttgtgggcggacctcccctgagcctgtctgaggggccagccct >GPX6_tool1 cccacctcacatgaagggaagggcatctccatgatggtggatcccaaaacccctctgggtcgcaccctgccagagccttccttggtgcctgtcc >GPX1_tool1 tgctgtctcgggggggttttcatctatgagggtgtttcctctaaacctacgagggaggaacacctgatcttacagaaaataccacctcgagatgg >GPX2_tool1 agacttgggtaagctctgggccttcacagaatgatggcaccttcctaaaccctcatgggtggtgtctgagaggcgtgaagggcctggagccactc >GPX4_tool1 ccacgcccttggagccttccaccggcactcatgacggcctgcctgcaaacctgctggtggggcagacccgaaaatccagcgtgcaccccgccgg >SEPW_tool1 gacccagcccctctcagcagacgcttcatgataggaaggactgaaaagtcttgtggacacctggtctttccctgatgttctcgtggctgctgttgg >DIO1_tool1 ttttaactctgtgtctttacatatttgtttatgatggccacagcctaaagtacacacggctgtgacttgattcaaaagaaaatgttataag >DIO2_tool1 cagagatgtgcagagttgaccagtgtgcggatgataactactgacgaaagagtcatcgactcagttagtggttggatgtagtcacattagtttgcctctc >DIO3_tool1 ttgggtgcacaggagccccactgctgatgacgaactatctctaactggtcttgaccacgagctagttctgaattgcaggggcctcaaagcagca >SEPP1a_right ttttctttttccagtgttctatttgctttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat >SEPP1b_right tatattgcttagtaagtatttccatagtcaatgatggtttaataggtaaaccaaaccctataaacctgac >SEPN_right cagtggcttccccggcagcagccccatgatggctgaatccgaaatcctcgatgggtccagcttgat >SEPHS2_right acctgcaaccatctgacttggtctctgttaatgacgtctctccctctaaaccccattaaggactgggagaggcagag >SELM1_right agagtgaaacattcacaaagatttgcgttaatgaagactacacagaaaacctttctagggatttgtgtggatcagat >MSRB1_right cctgccagccgccctggccctggtcactgcatgatccgctctggtcaaacccttccaggccagccagagtggggat >TXNRD1_right atttggcagggcatcgaagggatgcatccatgaagtcaccagtctcaagcccatgtggtaggcggtgatggaa >TXNRD3_right gacagcgagaagcagtgggactgcttccttgacgccttagcttggagccccgttatgaggtgagccaaggctgac >TXNRD2_right cacccccccccaggctcctggtgccagatgatgacgacctgggtggaaacctaccctgtgggcacccatgtccgag >SELS_right taggacagtctctgtgacaggttgcgttgaatgatgtcttccttatcaatggtgagcccaccagtgaggattactgat >SELT_right gatcattgcaagagcagcgtgactgacattatgaaggcctgtactgaagacagcaagctgttagtacagaccagat >SELO_right ctgccctggcccatgcacacccgtctttccatgatggcagagacatccagtcaggacctgacccgtctctgtctgag >SELV_right tttctctcccatcttaggagtctcagctggatgatgagaagggctgaaatgttgccaagtcaggtccttttctgat >SELH_right tttgtgtccctggtgatgttggaacattaatgatggaacatggccaaacttcagtcatgatcctgaa >SELI_right tttcactgaatgaagtttgtgcttgaatgaagagtgtatcttaaaccccctttttttggacaggctgcacttggat >SELK_right acaaggactgctctgtgtcctcacagatgaatgaggtcatgctgggaattccctctgcagggaactggcctgactgac >GPX3_right cacggaccccatggcaggggtggcgtcttcatgagggaggggcccaaagcccttgtgggcggacctcccctgag >GPX6_right cccacctcacatgaagggaagggcatctccatgatggtggatcccaaaacccctctgggtcgcaccctgccagag >GPX1_right tgctgtctcgggggggttttcatctatgagggtgtttcctctaaacctacgagggaggaacacctgat >GPX2_right agacttgggtaagctctgggccttcacagaatgatggcaccttcctaaaccctcatgggtggtgtctgag >GPX4_right ccacgcccttggagccttccaccggcactcatgacggcctgcctgcaaacctgctggtggggcagacccgaa >SEPW_right gacccagcccctctcagcagacgcttcatgataggaaggactgaaaagtcttgtggacacctggtctttccctgat >DIO1_right ttttaactctgtgtctttacatatttgtttatgatggccacagcctaaagtacacacggctgtgacttgat >DIO2_right cagagatgtgcagagttgaccagtgtgcggatgataactactgacgaaagagtcatcgactcagttagtggttggat >DIO3_right ttgggtgcacaggagccccactgctgatgacgaactatctctaactggtcttgaccacgagctagttctgaa >SEPP1a_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgg >SEPP1b_alex ttaatgagaatagaaacgtaaactatgacctaggggtttct >SEPN_alex ttgctttaatgagaatagaaacgtaaactatgacctaggggt >SEPHS2_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat >SELM1_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat >MSRB1_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga >TXNRD1_alex tttaatgagaatagaaacgtaaactatgacctaggggtttctgtt >TXNRD3_alex ctttaatgagaatagaaacgtaaactatgacctaggggtttctgttgg >TXNRD2_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga >SELS_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggata >SELT_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga >SELO_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat >SELV_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga >SELH_alex tttaatgagaatagaaacgtaaactatgacctaggggtt >SELI_alex tgctttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga >SELK_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggata >GPX3_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttg >GPX6_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgg >GPX1_alex ttgctttaatgagaatagaaacgtaaactatgacctaggggttt >GPX2_alex ttaatgagaatagaaacgtaaactatgacctaggggtttct >GPX4_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgt >SEPW_alex gctttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga >DIO1_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctg >DIO2_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat >DIO3_alex tgctttaatgagaatagaaacgtaaactatgacctaggggtttctgt
Blat queries by gene for custom SECIS track
>SEPP1a_left ttttctttttccagtgttctatttgctttaatgag >SEPP1a_mid ttttctttttccagtgttctatttgctttaatgagaatagaaacgtaa >SEPP1a_tool1 ttttctttttccagtgttctatttgctttaatgagaatagaaacgtaaactatgacctaggggtttctgttggataattagcagtttagaatggaggaa >SEPP1a_right ttttctttttccagtgttctatttgctttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat >SEPP1a_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgg >SEPP1b_left tatattgcttagtaagtatttccatagtcaatgat >SEPP1b_mid tatattgcttagtaagtatttccatagtcaatgatggtttaataggtaa >SEPP1b_tool1 tatattgcttagtaagtatttccatagtcaatgatggtttaataggtaaaccaaaccctataaacctgacctcctttatggttaatact >SEPP1b_right tatattgcttagtaagtatttccatagtcaatgatggtttaataggtaaaccaaaccctataaacctgac >SEPP1b_alex ttaatgagaatagaaacgtaaactatgacctaggggtttct >SEPN_left cagtggcttccccggcagcagccccatgat >SEPN_mid cagtggcttccccggcagcagccccatgatggctgaatccgaa >SEPN_tool1 cagtggcttccccggcagcagccccatgatggctgaatccgaaatcctcgatgggtccagcttgatgtctttgcagctgcacctat >SEPN_right cagtggcttccccggcagcagccccatgatggctgaatccgaaatcctcgatgggtccagcttgat >SEPN_alex ttgctttaatgagaatagaaacgtaaactatgacctaggggt >SEPHS2_left acctgcaaccatctgacttggtctctgttaatgac >SEPHS2_mid acctgcaaccatctgacttggtctctgttaatgacgtctctccctctaa >SEPHS2_tool1 acctgcaaccatctgacttggtctctgttaatgacgtctctccctctaaaccccattaaggactgggagaggcagagcaagcctcagagcccaggcct >SEPHS2_right acctgcaaccatctgacttggtctctgttaatgacgtctctccctctaaaccccattaaggactgggagaggcagag >SEPHS2_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat >SELM1_left agagtgaaacattcacaaagatttgcgttaatgaa >SELM1_mid agagtgaaacattcacaaagatttgcgttaatgaagactacacagaaa >SELM1_tool1 agagtgaaacattcacaaagatttgcgttaatgaagactacacagaaaacctttctagggatttgtgtggatcagatacatacttggcaaatttttgagt >SELM1_right agagtgaaacattcacaaagatttgcgttaatgaagactacacagaaaacctttctagggatttgtgtggatcagat >SELM1_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat >MSRB1_left cctgccagccgccctggccctggtcactgcatgat >MSRB1_mid cctgccagccgccctggccctggtcactgcatgatccgctctggtcaa >MSRB1_tool1 cctgccagccgccctggccctggtcactgcatgatccgctctggtcaaacccttccaggccagccagagtggggatggtctgtgacctgctgggaa >MSRB1_right cctgccagccgccctggccctggtcactgcatgatccgctctggtcaaacccttccaggccagccagagtggggat >MSRB1_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga >TXNRD1_left atttggcagggcatcgaagggatgcatccatgaa >TXNRD1_mid atttggcagggcatcgaagggatgcatccatgaagtcaccagtctcaa >TXNRD1_tool1 atttggcagggcatcgaagggatgcatccatgaagtcaccagtctcaagcccatgtggtaggcggtgatggaacaactgtcaaatcagttttagca >TXNRD1_right atttggcagggcatcgaagggatgcatccatgaagtcaccagtctcaagcccatgtggtaggcggtgatggaa >TXNRD1_alex tttaatgagaatagaaacgtaaactatgacctaggggtttctgtt >TXNRD3_left gacagcgagaagcagtgggactgcttccttgac >TXNRD3_mid gacagcgagaagcagtgggactgcttccttgacgccttagcttgg >TXNRD3_tool1 gacagcgagaagcagtgggactgcttccttgacgccttagcttggagccccgttatgaggtgagccaaggctgactctcgcaagccaggactgag >TXNRD3_right gacagcgagaagcagtgggactgcttccttgacgccttagcttggagccccgttatgaggtgagccaaggctgac >TXNRD3_alex ctttaatgagaatagaaacgtaaactatgacctaggggtttctgttgg >TXNRD2_left cacccccccccaggctcctggtgccagatgatgac >TXNRD2_mid cacccccccccaggctcctggtgccagatgatgacgacctgggtggaa >TXNRD2_tool1 cacccccccccaggctcctggtgccagatgatgacgacctgggtggaaacctaccctgtgggcacccatgtccgagccccctggcatttctgcaatgc >TXNRD2_right cacccccccccaggctcctggtgccagatgatgacgacctgggtggaaacctaccctgtgggcacccatgtccgag >TXNRD2_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga >SELS_left taggacagtctctgtgacaggttgcgttgaatgat >SELS_mid taggacagtctctgtgacaggttgcgttgaatgatgtcttccttatcaa >SELS_tool1 taggacagtctctgtgacaggttgcgttgaatgatgtcttccttatcaatggtgagcccaccagtgaggattactgatgtggacagttgatggggtttgt >SELS_right taggacagtctctgtgacaggttgcgttgaatgatgtcttccttatcaatggtgagcccaccagtgaggattactgat >SELS_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggata >SELT_left gatcattgcaagagcagcgtgactgacattatgaa >SELT_mid gatcattgcaagagcagcgtgactgacattatgaaggcctgtactgaa >SELT_tool1 gatcattgcaagagcagcgtgactgacattatgaaggcctgtactgaagacagcaagctgttagtacagaccagatgctttcttggcaggctcgt >SELT_right gatcattgcaagagcagcgtgactgacattatgaaggcctgtactgaagacagcaagctgttagtacagaccagat >SELT_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga >SELO_left ctgccctggcccatgcacacccgtctttccatgat >SELO_mid ctgccctggcccatgcacacccgtctttccatgatggcagagacatcc >SELO_tool1 ctgccctggcccatgcacacccgtctttccatgatggcagagacatccagtcaggacctgacccgtctctgtctgaggccggctcagcagtgcagcctggtc >SELO_right ctgccctggcccatgcacacccgtctttccatgatggcagagacatccagtcaggacctgacccgtctctgtctgag >SELO_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat >SELV_left tttctctcccatcttaggagtctcagctggatgat >SELV_mid tttctctcccatcttaggagtctcagctggatgatgagaagggctgaa >SELV_tool1 tttctctcccatcttaggagtctcagctggatgatgagaagggctgaaatgttgccaagtcaggtccttttctgatggtggctggggctggggtgag >SELV_right tttctctcccatcttaggagtctcagctggatgatgagaagggctgaaatgttgccaagtcaggtccttttctgat >SELV_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga >SELH_left tttgtgtccctggtgatgttggaacattaatgat >SELH_mid tttgtgtccctggtgatgttggaacattaatgatggaacatggccaa >SELH_tool1 tttgtgtccctggtgatgttggaacattaatgatggaacatggccaaacttcagtcatgatcctgaagccatggtttcttccctgc >SELH_right tttgtgtccctggtgatgttggaacattaatgatggaacatggccaaacttcagtcatgatcctgaa >SELH_alex tttaatgagaatagaaacgtaaactatgacctaggggtt >SELI_left tttcactgaatgaagtttgtgcttgaatgaa >SELI_mid tttcactgaatgaagtttgtgcttgaatgaagagtgtatcttaaa >SELI_tool1 tttcactgaatgaagtttgtgcttgaatgaagagtgtatcttaaaccccctttttttggacaggctgcacttggataaaataggcaccactgtgttgat >SELI_right tttcactgaatgaagtttgtgcttgaatgaagagtgtatcttaaaccccctttttttggacaggctgcacttggat >SELI_alex tgctttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga >SELK_left acaaggactgctctgtgtcctcacagatgaatgag >SELK_mid acaaggactgctctgtgtcctcacagatgaatgaggtcatgctgggaa >SELK_tool1 acaaggactgctctgtgtcctcacagatgaatgaggtcatgctgggaattccctctgcagggaactggcctgactgacatgcagttccataaatgcagatgtt >SELK_right acaaggactgctctgtgtcctcacagatgaatgaggtcatgctgggaattccctctgcagggaactggcctgactgac >SELK_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggata >GPX3_left cacggaccccatggcaggggtggcgtcttcatgag >GPX3_mid cacggaccccatggcaggggtggcgtcttcatgagggaggggcccaaa >GPX3_tool1 cacggaccccatggcaggggtggcgtcttcatgagggaggggcccaaagcccttgtgggcggacctcccctgagcctgtctgaggggccagccct >GPX3_right cacggaccccatggcaggggtggcgtcttcatgagggaggggcccaaagcccttgtgggcggacctcccctgag >GPX3_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttg >GPX6_left cccacctcacatgaagggaagggcatctccatgat >GPX6_mid cccacctcacatgaagggaagggcatctccatgatggtggatcccaa >GPX6_tool1 cccacctcacatgaagggaagggcatctccatgatggtggatcccaaaacccctctgggtcgcaccctgccagagccttccttggtgcctgtcc >GPX6_right cccacctcacatgaagggaagggcatctccatgatggtggatcccaaaacccctctgggtcgcaccctgccagag >GPX6_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgg >GPX1_left tgctgtctcgggggggttttcatctatgag >GPX1_mid tgctgtctcgggggggttttcatctatgagggtgtttcctctaa >GPX1_tool1 tgctgtctcgggggggttttcatctatgagggtgtttcctctaaacctacgagggaggaacacctgatcttacagaaaataccacctcgagatgg >GPX1_right tgctgtctcgggggggttttcatctatgagggtgtttcctctaaacctacgagggaggaacacctgat >GPX1_alex ttgctttaatgagaatagaaacgtaaactatgacctaggggttt >GPX2_left agacttgggtaagctctgggccttcacagaatgat >GPX2_mid agacttgggtaagctctgggccttcacagaatgatggcaccttcctaa >GPX2_tool1 agacttgggtaagctctgggccttcacagaatgatggcaccttcctaaaccctcatgggtggtgtctgagaggcgtgaagggcctggagccactc >GPX2_right agacttgggtaagctctgggccttcacagaatgatggcaccttcctaaaccctcatgggtggtgtctgag >GPX2_alex ttaatgagaatagaaacgtaaactatgacctaggggtttct >GPX4_left ccacgcccttggagccttccaccggcactcatgac >GPX4_mid ccacgcccttggagccttccaccggcactcatgacggcctgcctgca >GPX4_tool1 ccacgcccttggagccttccaccggcactcatgacggcctgcctgcaaacctgctggtggggcagacccgaaaatccagcgtgcaccccgccgg >GPX4_right ccacgcccttggagccttccaccggcactcatgacggcctgcctgcaaacctgctggtggggcagacccgaa >GPX4_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgt >SEPW_left gacccagcccctctcagcagacgcttcatgat >SEPW_mid gacccagcccctctcagcagacgcttcatgataggaaggactgaa >SEPW_tool1 gacccagcccctctcagcagacgcttcatgataggaaggactgaaaagtcttgtggacacctggtctttccctgatgttctcgtggctgctgttgg >SEPW_right gacccagcccctctcagcagacgcttcatgataggaaggactgaaaagtcttgtggacacctggtctttccctgat >SEPW_alex gctttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga >DIO1_left ttttaactctgtgtctttacatatttgtttatgat >DIO1_mid ttttaactctgtgtctttacatatttgtttatgatggccacagcctaa >DIO1_tool1 ttttaactctgtgtctttacatatttgtttatgatggccacagcctaaagtacacacggctgtgacttgattcaaaagaaaatgttataag >DIO1_right ttttaactctgtgtctttacatatttgtttatgatggccacagcctaaagtacacacggctgtgacttgat >DIO1_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctg >DIO2_left cagagatgtgcagagttgaccagtgtgcggatgat >DIO2_mid cagagatgtgcagagttgaccagtgtgcggatgataactactgacgaa >DIO2_tool1 cagagatgtgcagagttgaccagtgtgcggatgataactactgacgaaagagtcatcgactcagttagtggttggatgtagtcacattagtttgcctctc >DIO2_right cagagatgtgcagagttgaccagtgtgcggatgataactactgacgaaagagtcatcgactcagttagtggttggat >DIO2_alex ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat >DIO3_left ttgggtgcacaggagccccactgctgatgac >DIO3_mid ttgggtgcacaggagccccactgctgatgacgaactatctctaa >DIO3_tool1 ttgggtgcacaggagccccactgctgatgacgaactatctctaactggtcttgaccacgagctagttctgaattgcaggggcctcaaagcagca >DIO3_right ttgggtgcacaggagccccactgctgatgacgaactatctctaactggtcttgaccacgagctagttctgaa >DIO3_alex tgctttaatgagaatagaaacgtaaactatgacctaggggtttctgt
PSL data that generate SECIS custom track
35 0 0 0 0 0 0 0 + DIO1_left 35 0 35 chr1 247249719 54149213 54149248 1 35, 0, 54149213, 35 0 0 0 0 0 0 0 - DIO2_left 35 0 35 chr14 106368585 79733925 79733960 1 35, 0, 79733925, 31 0 0 0 0 0 0 0 + DIO3_left 31 0 31 chr14 106368585 101099070 101099101 1 31, 0, 101099070, 30 0 0 0 0 0 0 0 - GPX1_left 30 0 30 chr3 199501827 49369755 49369785 1 30, 0, 49369755, 24 0 0 0 0 0 1 50 + GPX2_left 35 0 24 chr21 46944323 17088438 17088512 2 6,18, 0,6, 17088438,17088494, 35 0 0 0 0 0 0 0 + GPX3_left 35 0 35 chr5 180857866 150388517 150388552 1 35, 0, 150388517, 35 0 0 0 0 0 0 0 + GPX4_left 35 0 35 chr19 63811651 1057605 1057640 1 35, 0, 1057605, 35 0 0 0 0 0 0 0 - GPX6_left 35 0 35 chr6 170899992 28579412 28579447 1 35, 0, 28579412, 35 0 0 0 0 0 0 0 - MSRB1_left 35 0 35 chr16 88827254 1928620 1928655 1 35, 0, 1928620, 34 0 0 0 0 0 0 0 + SELH_left 34 0 34 chr11 134452384 57266911 57266945 1 34, 0, 57266911, 31 0 0 0 0 0 0 0 + SELI_left 31 0 31 chr2 242951149 26466728 26466759 1 31, 0, 26466728, 34 1 0 0 0 0 0 0 - SELK_left 35 0 35 chr19 63811651 42875879 42875914 1 35, 0, 42875879, 35 0 0 0 0 0 0 0 - SELM1_left 35 0 35 chr1 247249719 87101135 87101170 1 35, 0, 87101135, 35 0 0 0 0 0 0 0 + SELO_left 35 0 35 chr22 49691432 48998023 48998058 1 35, 0, 48998023, 35 0 0 0 0 0 0 0 - SELS_left 35 0 35 chr15 100338915 99630129 99630164 1 35, 0, 99630129, 35 0 0 0 0 0 0 0 + SELT_left 35 0 35 chr3 199501827 151828144 151828179 1 35, 0, 151828144, 35 0 0 0 0 0 0 0 + SELV_left 35 0 35 chr19 63811651 44702608 44702643 1 35, 0, 44702608, 35 0 0 0 0 0 0 0 - SEPHS2_left 35 0 35 chr16 88827254 30362621 30362656 1 35, 0, 30362621, 30 0 0 0 0 0 0 0 + SEPN_left 30 0 30 chr1 247249719 26015876 26015906 1 30, 0, 26015876, 35 0 0 0 0 0 0 0 - SEPP1a_left 35 0 35 chr5 180857866 42836304 42836339 1 35, 0, 42836304, 35 0 0 0 0 0 0 0 - SEPP1b_left 35 0 35 chr5 180857866 42835869 42835904 1 35, 0, 42835869, 32 0 0 0 0 0 0 0 + SEPW_left 32 0 32 chr19 63811651 52979370 52979402 1 32, 0, 52979370, 34 0 0 0 0 0 0 0 + TXNRD1_left 34 0 34 chr12 132349534 103266544 103266578 1 34, 0, 103266544, 25 0 0 0 0 0 1 280 + TXNRD2_left 35 0 25 chr2 242951149 96918346 96918651 2 9,16, 0,9, 96918346,96918635, 33 0 0 0 0 0 0 0 - TXNRD3_left 33 0 33 chr3 199501827 127809209 127809242 1 33, 0, 127809209, 49 0 0 0 0 0 0 0 - SELS_mid 49 0 49 chr15 100338915 99630115 99630164 1 49, 0, 99630115, 49 0 0 0 0 0 0 0 - SEPHS2_mid 49 0 49 chr16 88827254 30362607 30362656 1 49, 0, 30362607, 49 0 0 0 0 0 0 0 - SEPP1b_mid 49 0 49 chr5 180857866 42835855 42835904 1 49, 0, 42835855, 48 0 0 0 0 0 0 0 - DIO2_mid 48 0 48 chr14 106368585 79733912 79733960 1 48, 0, 79733912, 48 0 0 0 0 0 0 0 + DIO1_mid 48 0 48 chr1 247249719 54149213 54149261 1 48, 0, 54149213, 48 0 0 0 0 0 0 0 - GPX2_mid 48 0 48 chr14 106368585 64475710 64475758 1 48, 0, 64475710, 48 0 0 0 0 0 0 0 + GPX3_mid 48 0 48 chr5 180857866 150388517 150388565 1 48, 0, 150388517, 48 0 0 0 0 0 0 0 - SELK_mid 48 0 48 chr3 199501827 53894466 53894514 1 48, 0, 53894466, 48 0 0 0 0 0 0 0 + SELV_mid 48 0 48 chr19 63811651 44702608 44702656 1 48, 0, 44702608, 48 0 0 0 0 0 0 0 + SELO_mid 48 0 48 chr22 49691432 48998023 48998071 1 48, 0, 48998023, 48 0 0 0 0 0 0 0 + SELT_mid 48 0 48 chr3 199501827 151828144 151828192 1 48, 0, 151828144, 48 0 0 0 0 0 0 0 - TXNRD2_mid 48 0 48 chr22 49691432 18243119 18243167 1 48, 0, 18243119, 48 0 0 0 0 0 0 0 + TXNRD1_mid 48 0 48 chr12 132349534 103266544 103266592 1 48, 0, 103266544, 48 0 0 0 0 0 0 0 - MSRB1_mid 48 0 48 chr16 88827254 1928607 1928655 1 48, 0, 1928607, 48 0 0 0 0 0 0 0 - SELM1_mid 48 0 48 chr1 247249719 87101122 87101170 1 48, 0, 87101122, 48 0 0 0 0 0 0 0 - SEPP1a_mid 48 0 48 chr5 180857866 42836291 42836339 1 48, 0, 42836291, 47 0 0 0 0 0 0 0 + GPX4_mid 47 0 47 chr19 63811651 1057605 1057652 1 47, 0, 1057605, 47 0 0 0 0 0 0 0 - GPX6_mid 47 0 47 chr6 170899992 28579400 28579447 1 47, 0, 28579400, 47 0 0 0 0 0 0 0 + SELH_mid 47 0 47 chr11 134452384 57266911 57266958 1 47, 0, 57266911, 45 0 0 0 0 0 0 0 + SEPW_mid 45 0 45 chr19 63811651 52979370 52979415 1 45, 0, 52979370, 46 1 0 0 0 0 0 0 - SELK_mid 48 0 47 chr19 63811651 42875867 42875914 1 47, 1, 42875867, 45 0 0 0 0 0 0 0 + SELI_mid 45 0 45 chr2 242951149 26466728 26466773 1 45, 0, 26466728, 45 0 0 0 0 0 0 0 - TXNRD3_mid 45 0 45 chr3 199501827 127809197 127809242 1 45, 0, 127809197, 44 0 0 0 0 0 0 0 + DIO3_mid 44 0 44 chr14 106368585 101099070 101099114 1 44, 0, 101099070, 44 0 0 0 0 0 0 0 - GPX1_mid 44 0 44 chr3 199501827 49369741 49369785 1 44, 0, 49369741, 46 2 0 0 0 0 0 0 + SELT_mid 48 0 48 chr9 140273252 6269196 6269244 1 48, 0, 6269196, 43 0 0 0 0 0 0 0 + SEPN_mid 43 0 43 chr1 247249719 26015876 26015919 1 43, 0, 26015876, 43 1 0 0 0 0 1 1 - GPX1_mid 44 0 44 chrX 154913754 13306693 13306738 2 39,5, 0,39, 13306693,13306733, 42 1 0 0 0 0 1 1 - GPX1_mid 44 1 44 chr21 46944323 27437452 27437496 2 39,4, 0,39, 27437452,27437492, 43 5 0 0 0 0 0 0 + SELM1_mid 48 0 48 chr14 106368585 67166253 67166301 1 48, 0, 67166253, 37 0 0 0 0 0 0 0 - SELK_mid 48 11 48 chr7 158821424 84315225 84315262 1 37, 0, 84315225, 38 3 0 0 0 0 0 0 + SEPHS2_mid 49 8 49 chr15 100338915 74570339 74570380 1 41, 8, 74570339, 36 1 0 0 1 11 1 9 - SELK_mid 48 0 48 chr19 63811651 10237164 10237210 2 21,16, 0,32, 10237164,10237194, 31 0 0 0 1 1 2 13 + GPX2_mid 48 11 43 chr13 114142980 38566319 38566363 3 19,7,5, 11,31,38, 38566319,38566349,38566358, 28 1 0 0 1 6 1 15 - DIO1_mid 48 13 48 chr5 180857866 61745707 61745751 2 11,18, 0,17, 61745707,61745733, 26 0 0 0 0 0 1 19 + SELO_mid 48 18 44 chr8 146274826 129396647 129396692 2 11,15, 18,29, 129396647,129396677, 25 0 0 0 0 0 1 280 + TXNRD2_mid 48 0 25 chr2 242951149 96918346 96918651 2 9,16, 0,9, 96918346,96918635, 24 0 0 0 0 0 1 50 + GPX2_mid 48 0 24 chr21 46944323 17088438 17088512 2 6,18, 0,6, 17088438,17088494, 25 0 0 0 1 6 1 1 - SEPP1a_mid 48 11 42 chr8 146274826 120166374 120166400 2 19,6, 6,31, 120166374,120166394, 24 0 0 0 0 0 1 1 + SEPP1a_mid 48 5 29 chr12 132349534 109866604 109866629 2 20,4, 5,25, 109866604,109866625, 22 1 0 0 0 0 0 0 - DIO3_mid 44 2 25 chr10 135374737 6117099 6117122 1 23, 19, 6117099, 21 1 0 0 0 0 0 0 + SEPW_mid 45 23 45 chr17 78774742 38842389 38842411 1 22, 23, 38842389, 20 0 0 0 0 0 0 0 - SELO_mid 48 1 21 chr7 158821424 132098648 132098668 1 20, 27, 132098648, 20 0 0 0 0 0 0 0 + SELO_mid 48 27 47 chr12 132349534 70427659 70427679 1 20, 27, 70427659, 20 0 0 0 0 0 0 0 - SEPP1a_mid 48 12 32 chr1 247249719 225373102 225373122 1 20, 16, 225373102, 103 0 0 0 0 0 0 0 - SELK_tool1 103 0 103 chr3 199501827 53894411 53894514 1 103, 0, 53894411, 102 0 0 0 0 0 0 0 + SELO_tool1 102 0 102 chr22 49691432 48998023 48998125 1 102, 0, 48998023, 100 0 0 0 0 0 0 0 - DIO2_tool1 100 0 100 chr14 106368585 79733860 79733960 1 100, 0, 79733860, 100 0 0 0 0 0 0 0 - SELS_tool1 100 0 100 chr15 100338915 99630064 99630164 1 100, 0, 99630064, 100 0 0 0 0 0 0 0 - SELM1_tool1 100 0 100 chr1 247249719 87101070 87101170 1 100, 0, 87101070, 99 0 0 0 0 0 0 0 + SELI_tool1 99 0 99 chr2 242951149 26466728 26466827 1 99, 0, 26466728, 99 0 0 0 0 0 0 0 - SEPP1a_tool1 99 0 99 chr5 180857866 42836240 42836339 1 99, 0, 42836240, 98 0 0 0 0 0 0 0 - TXNRD2_tool1 98 0 98 chr22 49691432 18243069 18243167 1 98, 0, 18243069, 98 0 0 0 0 0 0 0 - SEPHS2_tool1 98 0 98 chr16 88827254 30362558 30362656 1 98, 0, 30362558, 97 0 0 0 0 0 0 0 + SELV_tool1 97 0 97 chr19 63811651 44702608 44702705 1 97, 0, 44702608, 96 0 0 0 0 0 0 0 + SEPW_tool1 96 0 96 chr19 63811651 52979370 52979466 1 96, 0, 52979370, 96 0 0 0 0 0 0 0 + TXNRD1_tool1 96 0 96 chr12 132349534 103266544 103266640 1 96, 0, 103266544, 96 0 0 0 0 0 0 0 - MSRB1_tool1 96 0 96 chr16 88827254 1928559 1928655 1 96, 0, 1928559, 95 0 0 0 0 0 0 0 - GPX2_tool1 95 0 95 chr14 106368585 64475663 64475758 1 95, 0, 64475663, 95 0 0 0 0 0 0 0 - GPX1_tool1 95 0 95 chr3 199501827 49369690 49369785 1 95, 0, 49369690, 95 0 0 0 0 0 0 0 + GPX3_tool1 95 0 95 chr5 180857866 150388517 150388612 1 95, 0, 150388517, 95 0 0 0 0 0 0 0 + SELT_tool1 95 0 95 chr3 199501827 151828144 151828239 1 95, 0, 151828144, 95 0 0 0 0 0 0 0 - TXNRD3_tool1 95 0 95 chr3 199501827 127809147 127809242 1 95, 0, 127809147, 94 0 0 0 0 0 0 0 + DIO3_tool1 94 0 94 chr14 106368585 101099070 101099164 1 94, 0, 101099070, 94 0 0 0 0 0 0 0 + GPX4_tool1 94 0 94 chr19 63811651 1057605 1057699 1 94, 0, 1057605, 94 0 0 0 0 0 0 0 - GPX6_tool1 94 0 94 chr6 170899992 28579353 28579447 1 94, 0, 28579353, 91 0 0 0 0 0 0 0 + DIO1_tool1 91 0 91 chr1 247249719 54149213 54149304 1 91, 0, 54149213, 93 4 0 0 0 0 0 0 - SELK_tool1 103 0 97 chr19 63811651 42875817 42875914 1 97, 6, 42875817, 89 0 0 0 0 0 0 0 - SEPP1b_tool1 89 0 89 chr5 180857866 42835815 42835904 1 89, 0, 42835815, 91 4 0 0 0 0 1 1 - GPX1_tool1 95 0 95 chrX 154913754 13306642 13306738 2 90,5, 0,90, 13306642,13306733, 86 0 0 0 0 0 0 0 + SELH_tool1 86 0 86 chr11 134452384 57266911 57266997 1 86, 0, 57266911, 86 0 0 0 0 0 0 0 + SEPN_tool1 86 0 86 chr1 247249719 26015876 26015962 1 86, 0, 26015876, 89 3 0 0 1 1 0 0 - SELK_tool1 103 4 97 chr6 170899992 132182428 132182520 2 28,64, 6,35, 132182428,132182456, 92 8 0 0 0 0 0 0 + SELM1_tool1 100 0 100 chr14 106368585 67166253 67166353 1 100, 0, 67166253, 82 1 0 0 0 0 0 0 - SELK_tool1 103 11 94 chr7 158821424 84315179 84315262 1 83, 9, 84315179, 86 3 0 0 1 5 2 5 - GPX1_tool1 95 1 95 chr21 46944323 27437402 27437496 3 42,43,4, 0,47,90, 27437402,27437448,27437492, 87 9 0 0 1 1 0 0 + SELK_tool1 103 0 97 chr6 170899992 119211098 119211194 2 69,27, 0,70, 119211098,119211167, 80 4 0 0 0 0 0 0 + SELT_tool1 95 0 84 chr9 140273252 6269196 6269280 1 84, 0, 6269196, 82 9 0 0 1 7 0 0 + SEPHS2_tool1 98 0 98 chr5 180857866 15015120 15015211 2 20,71, 0,27, 15015120,15015140, 80 4 0 0 3 13 2 14 - SELK_tool1 103 0 97 chr19 63811651 10237112 10237210 4 9,23,36,16, 6,16,40,87, 10237112,10237126,10237149,10237194, 80 10 0 0 0 0 0 0 + SEPHS2_tool1 98 8 98 chr15 100338915 74570339 74570429 1 90, 8, 74570339, 31 0 0 0 1 1 2 13 + GPX2_tool1 95 11 43 chr13 114142980 38566319 38566363 3 19,7,5, 11,31,38, 38566319,38566349,38566358, 29 0 0 0 0 0 2 8 + SELH_tool1 86 46 75 chr2 242951149 71587400 71587437 3 9,3,17, 46,55,58, 71587400,71587415,71587420, 27 0 0 0 0 0 1 461 + SELV_tool1 97 70 97 chr5 180857866 76323311 76323799 2 22,5, 70,92, 76323311,76323794, 26 0 0 0 1 2 0 0 + GPX3_tool1 95 40 68 chr10 135374737 3081106 3081132 2 5,21, 40,47, 3081106,3081111, 26 0 0 0 0 0 1 19 + SELO_tool1 102 18 44 chr8 146274826 129396647 129396692 2 11,15, 18,29, 129396647,129396677, 26 0 0 0 1 3 1 19 - SEPW_tool1 96 47 76 chrX 154913754 149844331 149844376 2 9,17, 20,32, 149844331,149844359, 25 0 0 0 1 6 0 0 + SELI_tool1 99 50 81 chr8 146274826 59646157 59646182 2 19,6, 50,75, 59646157,59646176, 25 0 0 0 0 0 1 364 + SELH_tool1 86 61 86 chr16 88827254 17192425 17192814 2 16,9, 61,77, 17192425,17192805, 25 0 0 0 0 0 1 280 + TXNRD2_tool1 98 0 25 chr2 242951149 96918346 96918651 2 9,16, 0,9, 96918346,96918635, 26 2 0 0 0 0 0 0 + SEPHS2_tool1 98 59 87 chr2 242951149 3030319 3030347 1 28, 59, 3030319, 24 0 0 0 0 0 1 50 + GPX2_tool1 95 0 24 chr21 46944323 17088438 17088512 2 6,18, 0,6, 17088438,17088494, 25 0 0 0 1 6 1 1 - SEPP1a_tool1 99 11 42 chr8 146274826 120166374 120166400 2 19,6, 57,82, 120166374,120166394, 24 0 0 0 0 0 1 1 + SEPP1a_tool1 99 5 29 chr12 132349534 109866604 109866629 2 20,4, 5,25, 109866604,109866625, 23 1 0 0 0 0 0 0 + SEPW_tool1 96 23 47 chr17 78774742 38842389 38842413 1 24, 23, 38842389, 22 0 0 0 0 0 0 0 - SELM1_tool1 100 71 93 chr10 135374737 95402789 95402811 1 22, 7, 95402789, 23 0 0 0 0 0 1 5 + SEPP1b_tool1 89 30 53 chr8 146274826 107648419 107648447 2 17,6, 30,47, 107648419,107648441, 21 0 0 0 0 0 0 0 - SELV_tool1 97 73 94 chr3 199501827 132624985 132625006 1 21, 3, 132624985, 21 0 0 0 0 0 0 0 - SEPHS2_tool1 98 58 79 chr21 46944323 45665269 45665290 1 21, 19, 45665269, 22 0 0 0 0 0 1 1 + SEPP1a_tool1 99 69 91 chr9 140273252 3941728 3941751 2 4,18, 69,73, 3941728,3941733, 20 0 0 0 0 0 0 0 - DIO2_tool1 100 62 82 chr3 199501827 11771130 11771150 1 20, 18, 11771130, 20 0 0 0 0 0 0 0 - SEPW_tool1 96 61 81 chr15 100338915 75994315 75994335 1 20, 15, 75994315, 20 0 0 0 0 0 0 0 - SEPW_tool1 96 61 81 chr15 100338915 72150038 72150058 1 20, 15, 72150038, 20 0 0 0 0 0 0 0 + SEPW_tool1 96 61 81 chr15 100338915 73349835 73349855 1 20, 61, 73349835, 20 0 0 0 0 0 0 0 + SEPW_tool1 96 61 81 chr15 100338915 73374114 73374134 1 20, 61, 73374114, 20 0 0 0 0 0 0 0 + SEPW_tool1 96 61 81 chr15 100338915 70745981 70746001 1 20, 61, 70745981, 20 0 0 0 0 0 0 0 + GPX6_tool1 94 62 82 chr2 242951149 127577589 127577609 1 20, 62, 127577589, 20 0 0 0 0 0 0 0 - SELI_tool1 99 50 70 chr4 191273063 144776923 144776943 1 20, 29, 144776923, 20 0 0 0 0 0 0 0 - SELO_tool1 102 1 21 chr7 158821424 132098648 132098668 1 20, 81, 132098648, 20 0 0 0 0 0 0 0 + SELO_tool1 102 27 47 chr12 132349534 70427659 70427679 1 20, 27, 70427659, 20 0 0 0 0 0 0 0 + SELT_tool1 95 62 82 chr20 62435964 39921840 39921860 1 20, 62, 39921840, 20 0 0 0 0 0 0 0 + MSRB1_tool1 96 75 95 chr3 199501827 190025059 190025079 1 20, 75, 190025059, 20 0 0 0 0 0 0 0 - SEPP1b_tool1 89 41 61 chr17 78774742 50700873 50700893 1 20, 28, 50700873, 20 0 0 0 0 0 0 0 + SEPP1b_tool1 89 34 54 chr10 135374737 13298866 13298886 1 20, 34, 13298866, 20 0 0 0 0 0 0 0 - SEPP1a_tool1 99 12 32 chr1 247249719 225373102 225373122 1 20, 67, 225373102, 78 0 0 0 0 0 0 0 - SELK_right 78 0 78 chr3 199501827 53894436 53894514 1 78, 0, 53894436, 78 0 0 0 0 0 0 0 - SELS_right 78 0 78 chr15 100338915 99630086 99630164 1 78, 0, 99630086, 77 0 0 0 0 0 0 0 - DIO2_right 77 0 77 chr14 106368585 79733883 79733960 1 77, 0, 79733883, 77 0 0 0 0 0 0 0 + SELO_right 77 0 77 chr22 49691432 48998023 48998100 1 77, 0, 48998023, 77 0 0 0 0 0 0 0 - SELM1_right 77 0 77 chr1 247249719 87101093 87101170 1 77, 0, 87101093, 77 0 0 0 0 0 0 0 - SEPHS2_right 77 0 77 chr16 88827254 30362579 30362656 1 77, 0, 30362579, 76 0 0 0 0 0 0 0 + SEPW_right 76 0 76 chr19 63811651 52979370 52979446 1 76, 0, 52979370, 76 0 0 0 0 0 0 0 + SELI_right 76 0 76 chr2 242951149 26466728 26466804 1 76, 0, 26466728, 76 0 0 0 0 0 0 0 + SELV_right 76 0 76 chr19 63811651 44702608 44702684 1 76, 0, 44702608, 76 0 0 0 0 0 0 0 + SELT_right 76 0 76 chr3 199501827 151828144 151828220 1 76, 0, 151828144, 76 0 0 0 0 0 0 0 - TXNRD2_right 76 0 76 chr22 49691432 18243091 18243167 1 76, 0, 18243091, 76 0 0 0 0 0 0 0 - MSRB1_right 76 0 76 chr16 88827254 1928579 1928655 1 76, 0, 1928579, 75 0 0 0 0 0 0 0 - GPX6_right 75 0 75 chr6 170899992 28579372 28579447 1 75, 0, 28579372, 75 0 0 0 0 0 0 0 - TXNRD3_right 75 0 75 chr3 199501827 127809167 127809242 1 75, 0, 127809167, 75 0 0 0 0 0 0 0 - SEPP1a_right 75 0 75 chr5 180857866 42836264 42836339 1 75, 0, 42836264, 74 0 0 0 0 0 0 0 + GPX3_right 74 0 74 chr5 180857866 150388517 150388591 1 74, 0, 150388517, 73 0 0 0 0 0 0 0 + TXNRD1_right 73 0 73 chr12 132349534 103266544 103266617 1 73, 0, 103266544, 72 0 0 0 0 0 0 0 + DIO3_right 72 0 72 chr14 106368585 101099070 101099142 1 72, 0, 101099070, 72 0 0 0 0 0 0 0 + GPX4_right 72 0 72 chr19 63811651 1057605 1057677 1 72, 0, 1057605, 75 3 0 0 0 0 0 0 - SELK_right 78 0 78 chr19 63811651 42875836 42875914 1 78, 0, 42875836, 71 0 0 0 0 0 0 0 + DIO1_right 71 0 71 chr1 247249719 54149213 54149284 1 71, 0, 54149213, 70 0 0 0 0 0 0 0 - GPX2_right 70 0 70 chr14 106368585 64475688 64475758 1 70, 0, 64475688, 70 0 0 0 0 0 0 0 - SEPP1b_right 70 0 70 chr5 180857866 42835834 42835904 1 70, 0, 42835834, 68 0 0 0 0 0 0 0 - GPX1_right 68 0 68 chr3 199501827 49369717 49369785 1 68, 0, 49369717, 71 2 0 0 1 1 0 0 - SELK_right 78 4 78 chr6 170899992 132182447 132182520 2 8,65, 0,9, 132182447,132182455, 72 4 0 0 0 0 0 0 + SELT_right 76 0 76 chr9 140273252 6269196 6269272 1 76, 0, 6269196, 67 0 0 0 0 0 0 0 + SELH_right 67 0 67 chr11 134452384 57266911 57266978 1 67, 0, 57266911, 66 0 0 0 0 0 0 0 + SEPN_right 66 0 66 chr1 247249719 26015876 26015942 1 66, 0, 26015876, 66 1 0 0 0 0 0 0 - SELK_right 78 11 78 chr7 158821424 84315195 84315262 1 67, 0, 84315195, 66 2 0 0 0 0 1 1 - GPX1_right 68 0 68 chrX 154913754 13306669 13306738 2 63,5, 0,63, 13306669,13306733, 70 7 0 0 0 0 0 0 + SELM1_right 77 0 77 chr14 106368585 67166253 67166330 1 77, 0, 67166253, 65 4 0 0 1 7 0 0 + SEPHS2_right 77 0 76 chr5 180857866 15015120 15015189 2 20,49, 0,27, 15015120,15015140, 61 1 0 0 1 5 2 5 - GPX1_right 68 1 68 chr21 46944323 27437429 27437496 3 15,43,4, 0,20,63, 27437429,27437448,27437492, 63 6 0 0 0 0 0 0 + SELK_right 78 0 69 chr6 170899992 119211098 119211167 1 69, 0, 119211098, 63 6 0 0 0 0 0 0 + SEPHS2_right 77 8 77 chr15 100338915 74570339 74570408 1 69, 8, 74570339, 60 2 0 0 2 12 1 9 - SELK_right 78 0 74 chr19 63811651 10237139 10237210 3 10,36,16, 4,15,62, 10237139,10237149,10237194, 31 0 0 0 1 1 2 13 + GPX2_right 70 11 43 chr13 114142980 38566319 38566363 3 19,7,5, 11,31,38, 38566319,38566349,38566358, 26 0 0 0 1 2 0 0 + GPX3_right 74 40 68 chr10 135374737 3081106 3081132 2 5,21, 40,47, 3081106,3081111, 26 0 0 0 0 0 1 19 + SELO_right 77 18 44 chr8 146274826 129396647 129396692 2 11,15, 18,29, 129396647,129396677, 26 0 0 0 1 3 1 19 - SEPW_right 76 47 76 chrX 154913754 149844331 149844376 2 9,17, 0,12, 149844331,149844359, 25 0 0 0 0 0 1 280 + TXNRD2_right 76 0 25 chr2 242951149 96918346 96918651 2 9,16, 0,9, 96918346,96918635, 24 0 0 0 0 0 1 50 + GPX2_right 70 0 24 chr21 46944323 17088438 17088512 2 6,18, 0,6, 17088438,17088494, 24 0 0 0 0 0 1 1 + SEPP1a_right 75 5 29 chr12 132349534 109866604 109866629 2 20,4, 5,25, 109866604,109866625, 23 1 0 0 0 0 0 0 + SEPW_right 76 23 47 chr17 78774742 38842389 38842413 1 24, 23, 38842389, 23 0 0 0 0 0 1 5 + SEPP1b_right 70 30 53 chr8 146274826 107648419 107648447 2 17,6, 30,47, 107648419,107648441, 22 0 0 0 0 0 1 1 - MSRB1_right 76 53 75 chr20 62435964 55444749 55444772 2 5,17, 1,6, 55444749,55444755, 20 0 0 0 0 0 0 0 - SELI_right 76 50 70 chr4 191273063 144776923 144776943 1 20, 6, 144776923, 20 0 0 0 0 0 0 0 - SELO_right 77 1 21 chr7 158821424 132098648 132098668 1 20, 56, 132098648, 20 0 0 0 0 0 0 0 + SELO_right 77 27 47 chr12 132349534 70427659 70427679 1 20, 27, 70427659, 20 0 0 0 0 0 0 0 - SEPP1b_right 70 41 61 chr17 78774742 50700873 50700893 1 20, 9, 50700873, 20 0 0 0 0 0 0 0 + SEPP1b_right 70 34 54 chr10 135374737 13298866 13298886 1 20, 34, 13298866, 20 0 0 0 0 0 0 0 - SEPP1a_right 75 12 32 chr1 247249719 225373102 225373122 1 20, 43, 225373102, 51 0 0 0 0 0 0 0 - SELI_alex 51 0 51 chr5 180857866 42836265 42836316 1 51, 0, 42836265, 50 0 0 0 0 0 0 0 - SEPW_alex 50 0 50 chr5 180857866 42836265 42836315 1 50, 0, 42836265, 49 0 0 0 0 0 0 0 - SELK_alex 49 0 49 chr5 180857866 42836263 42836312 1 49, 0, 42836263, 49 0 0 0 0 0 0 0 - SELS_alex 49 0 49 chr5 180857866 42836263 42836312 1 49, 0, 42836263, 48 0 0 0 0 0 0 0 - DIO2_alex 48 0 48 chr5 180857866 42836264 42836312 1 48, 0, 42836264, 48 0 0 0 0 0 0 0 - SELO_alex 48 0 48 chr5 180857866 42836264 42836312 1 48, 0, 42836264, 48 0 0 0 0 0 0 0 - TXNRD3_alex 48 0 48 chr5 180857866 42836266 42836314 1 48, 0, 42836266, 48 0 0 0 0 0 0 0 - SELM1_alex 48 0 48 chr5 180857866 42836264 42836312 1 48, 0, 42836264, 48 0 0 0 0 0 0 0 - SEPHS2_alex 48 0 48 chr5 180857866 42836264 42836312 1 48, 0, 42836264, 47 0 0 0 0 0 0 0 - DIO3_alex 47 0 47 chr5 180857866 42836269 42836316 1 47, 0, 42836269, 47 0 0 0 0 0 0 0 - SELV_alex 47 0 47 chr5 180857866 42836265 42836312 1 47, 0, 42836265, 47 0 0 0 0 0 0 0 - SELT_alex 47 0 47 chr5 180857866 42836265 42836312 1 47, 0, 42836265, 47 0 0 0 0 0 0 0 - TXNRD2_alex 47 0 47 chr5 180857866 42836265 42836312 1 47, 0, 42836265, 47 0 0 0 0 0 0 0 - MSRB1_alex 47 0 47 chr5 180857866 42836265 42836312 1 47, 0, 42836265, 46 0 0 0 0 0 0 0 - GPX6_alex 46 0 46 chr5 180857866 42836266 42836312 1 46, 0, 42836266, 46 0 0 0 0 0 0 0 - SEPP1a_alex 46 0 46 chr5 180857866 42836266 42836312 1 46, 0, 42836266, 45 0 0 0 0 0 0 0 - GPX3_alex 45 0 45 chr5 180857866 42836267 42836312 1 45, 0, 42836267, 45 0 0 0 0 0 0 0 - TXNRD1_alex 45 0 45 chr5 180857866 42836268 42836313 1 45, 0, 42836268, 44 0 0 0 0 0 0 0 - GPX1_alex 44 0 44 chr5 180857866 42836273 42836317 1 44, 0, 42836273, 43 0 0 0 0 0 0 0 - GPX4_alex 43 0 43 chr5 180857866 42836269 42836312 1 43, 0, 42836269, 42 0 0 0 0 0 0 0 - DIO1_alex 42 0 42 chr5 180857866 42836270 42836312 1 42, 0, 42836270, 42 0 0 0 0 0 0 0 - SEPN_alex 42 0 42 chr5 180857866 42836275 42836317 1 42, 0, 42836275, 41 0 0 0 0 0 0 0 - GPX2_alex 41 0 41 chr5 180857866 42836271 42836312 1 41, 0, 42836271, 41 0 0 0 0 0 0 0 - SEPP1b_alex 41 0 41 chr5 180857866 42836271 42836312 1 41, 0, 42836271, 39 0 0 0 0 0 0 0 - SELH_alex 39 0 39 chr5 180857866 42836274 42836313 1 39, 0, 42836274, 21 1 0 0 0 0 0 0 - GPX1_alex 44 0 22 chrX 154913754 74223907 74223929 1 22, 22, 74223907, 21 1 0 0 0 0 0 0 - SEPN_alex 42 0 22 chrX 154913754 74223907 74223929 1 22, 20, 74223907,
PSL data that generate boreoeutherian custom track
84 7 0 0 0 0 0 0 + DIO1_tool1 91 0 91 chr1 169519511 40171838 40171929 1 91, 0, 40171838, 92 4 0 0 0 0 0 0 - DIO2_tool1 100 4 100 chr14 126455928 105764192 105764288 1 96, 0, 105764192, 88 6 0 0 0 0 0 0 + DIO3_tool1 94 0 94 chr14 126455928 123303991 123304085 1 94, 0, 123303991, 87 5 0 0 0 0 0 0 - GPX2_tool1 95 0 92 chr14 126455928 93515719 93515811 1 92, 3, 93515719, 85 4 0 0 0 0 0 0 + GPX3_tool1 95 6 95 chr5 135438014 111596045 111596134 1 89, 6, 111596045, 85 7 0 0 0 0 3 6 + GPX4_tool1 94 2 94 chr19 11836958 494587 494685 4 21,31,35,5, 2,23,54,89, 494587,494609,494644,494680, 88 6 0 0 0 0 0 0 - GPX6_tool1 94 0 94 chr6 128772084 22570259 22570353 1 94, 0, 22570259, 68 4 0 0 0 0 0 0 - MSRB1_tool1 96 22 94 chr16a 21784349 1375915 1375987 1 72, 2, 1375915, 74 5 0 0 0 0 0 0 + SELH_tool1 86 4 83 chr11 100778330 88371632 88371711 1 79, 4, 88371632, 95 4 0 0 0 0 0 0 + SELI_tool1 99 0 99 chr2a 83993180 21144892 21144991 1 99, 0, 21144892, 91 4 0 0 1 5 1 1 - SELM1_tool1 100 0 100 chr1 169519511 66580051 66580147 2 17,78, 0,22, 66580051,66580069, 91 4 0 0 1 5 1 1 + SELM1_tool1 100 0 100 chr14 126455928 95588814 95588910 2 78,17, 0,83, 95588814,95588893, 70 3 0 0 0 0 0 0 + SELO_tool1 102 20 93 chr12a 94328666 93913600 93913673 1 73, 20, 93913600, 98 2 0 0 0 0 0 0 + SELS_tool1 100 0 100 chr14 126455928 6005591 6005691 1 100, 0, 6005591, 90 7 0 0 0 0 0 0 - SELS_tool1 100 0 97 chr14 126455928 3441919 3442016 1 97, 3, 3441919, 95 0 0 0 0 0 1 93 - SELT_tool1 95 0 95 chr3 176510875 97714857 97715045 2 90,5, 0,90, 97714857,97715040, 88 2 0 0 0 0 0 0 + SELT_tool1 95 5 95 chr9 83807521 22270311 22270401 1 90, 5, 22270311, 86 4 0 0 0 0 0 0 + SELV_tool1 97 7 97 chr16b 53486001 42050779 42050869 1 90, 7, 42050779, 94 4 0 0 0 0 0 0 + SEPHS2_tool1 98 0 98 chr5 135438014 12044148 12044246 1 98, 0, 12044148, 93 5 0 0 0 0 0 0 - SEPHS2_tool1 98 0 98 chr16a 21784349 21020047 21020145 1 98, 0, 21020047, 83 3 0 0 0 0 0 0 + SEPHS2_tool1 98 12 98 chr14 126455928 24823440 24823526 1 86, 12, 24823440, 79 6 0 0 1 1 1 2 + SEPN_tool1 86 0 86 chr1 169519511 18769015 18769102 2 13,72, 0,14, 18769015,18769030, 93 6 0 0 0 0 0 0 - SEPP1a_tool1 99 0 99 chr5 135438014 32424675 32424774 1 99, 0, 32424675, 78 6 0 0 0 0 0 0 - SEPP1b_tool1 89 5 89 chr5 135438014 32424222 32424306 1 84, 0, 32424222, 74 6 0 0 0 0 0 0 + SEPW_tool1 96 0 80 chr16b 53486001 46899188 46899268 1 80, 0, 46899188, 90 6 0 0 0 0 0 0 + TXNRD1_tool1 96 0 96 chr12a 94328666 77277518 77277614 1 96, 0, 77277518, 72 7 0 0 1 10 1 11 + TXNRD2_tool1 98 3 92 chr12b 28829889 27296171 27296261 2 60,19, 3,73, 27296171,27296242, 77 12 0 0 0 0 1 1 + TXNRD3_tool1 95 0 89 chr3 176510875 176010292 176010382 2 83,6, 0,83, 176010292,176010376,
Description of the custom SECIS track
These blat markers serve to designate key regions in non-coding downstream regions of a full set of 25 mammalian selenoproteins. The SECIS feature critical to insertion of selenocysteine at the ribosome occurs in 3' UTR. However the extent of the this region is under debate because the traditional boundaries defined by the SECISearch 2.0 web tool is too short relative to peaks in comparative genomics conservation defined by the phastCons track, yet too long for the region defined by a new Cove SECIS web tool.
Five kinds of Blat sequences marker are used to make this track. The first is simply downstream non-coding mRNA, which provides a visual context of the entire region when the browser is opened to that width. The next three markers (defined by spaces in SECISearch tool output) denote the start up to the ATGAA portion of the kink-turn, up to AA in the apical loop, and up the complementary AGAT of the kink-turn stem. The final blat marker shows output of the new Cove tool.
Overall, this custom track allows quick visual comparisons of the three main prediction schemes for the SECIS insertion element. The track synergizes with the collection and comparative genomics analysis of selenoproteins and their insertion elements at the UCSC genomeWiki project. The track configuration specified at the wiki for interactive multi-display displays actual basepair differences to be seen relative to human on all but the longest mRNA blat track
Methods for generating the data are discussed within the selenoprotein comparative genomics page. Briefly, fully validated human representatives and placental mammal orthologous counterparts are collected and parsed with the SECIS tools to generate appropriate Blat queries. The 25 queries for each gene saturate the allowed query complexity at Blat so the psl-formatted output of 5 separate queries must be concatenated to create the input to the custom track.
The SECIS elements are validated by 6 methods: the correct position in 3' UTR, correct positive strand, occurence over a phastCons peak in the 28-species alignment, recognition by the two SECIS web tools that use the rnaFold algorithm, and agreement with experimental results for individual genesat PubMed when available..
Credits for the thousands of individuals involved in producing the underlying data for UCSC browser, each of the tracks used here, and the genomeWiki infrastructure are provided on that site.. Individual contributions to the selenoprotein pages including this custom track in the community-collaborative genomeWiki are specified at its update blog.
References:
"SECIS" provides an effective keyword search at PubMed. Each of the 166 literature references has contributed to our understanding of selenocysteine insertion. The bibiliographies of those papers, especially very recent ones, provide comprehensive coverage of selenocysteine insertion elements.
1. Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, Rosenbloom K, Clawson H, Spieth J, Hillier LW, Richards S, et al. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome Res. 2005 Aug;15(8):1034-50.
2. Kryukov, G. V., Castellano, S., Novoselov, S. V., Lobanov, A. V., Zehtab, O., Guigo R, Gladyshev, V. N. Characterization of mammalian selenoproteomes (2003) Science, 300, 1439-1443. [full text]
3. Wilm A, Linnenbrink K, Steger G. ConStruct: Improved construction of RNA consensus structures. BMC Bioinformatics. 2008 Apr 28;9:219. [full text]
4. Castellano S, Gladyshev VN, Guigó R, Berry MJ. SelenoDB 1.0 : a database of selenoprotein genes, proteins and SECIS elements. Nucleic Acids Res. 2008 Jan;36(Database issue):D332-8. [full text]
5. The Cove tool is unpublished work of Alexei Lobanov, Perry Ridge and Vadim N. Gladyshev at the Redox Biology Center, University of Nebraska, Lincoln.
6. The genomeWiki site is provided and maintained by Hiram Clawson of UCSC. Content for the comparative genomics category including the selenoprotein section is provided by Tom Pringle of the Sperling Foundation and the biomedical research community at large.