Conservation Track QA

QAing Conservation and Most Conserved tracks for a new assembly

(using the ponAbe2 (orangutan) assembly as an example throughout)

Make a list of tables:

• multiz8way
• multiz8wayFrames
• multiz8waySummary
• phastCons8way
• phastConsElements8way
• seq
• extFile

Make a list of files to go to hgnfs1:

• /gbdb/ponAbe2/multiz8way/phastCons8way.wib
• /gbdb/ponAbe2/multiz8way/anno/maf/*

Make a list of files to go to hgdownload:

• /usr/local/apache/htdocs/goldenPath/ponAbe2/phastCons8way/*.*
• /usr/local/apache/htdocs/goldenPath/ponAbe2/phastCons8way/phastConsScores/*
• /usr/local/apache/htdocs/goldenPath/ponAbe2/multiz8way/*.*
• /usr/local/apache/htdocs/goldenPath/ponAbe2/multiz8way/maf/*

Make a list of all organisms in the Conservation track:

orangutan	Pan troglodytes	July 2007	ponAbe2
human	Homo sapiens	Mar 2006	hg18
chimpanzee	Pan troglodytes	Mar 2006	panTro2
rhesus	Macaca mulatta	Jan 2006	rheMac2
marmoset	Callithrix jacchus	June 2007	calJac1
mouse	Mus musculus	July 2007	mm9
opossum	Monodelphis domestica	Jan 2006	monDom4
platypus	Ornithorhychus anatinus	Mar 2007	ornAna1

Make a list of all organisms for which there are nets & chains:

(put in order of furthest from this species to closest)

• ornAna1
• monDom4
• mm9
• rheMac2
• panTro2
• hg18

Check the following in the files:

Check annotated maf files for overlapping blocks:

[hgwdev:/gbdb/ponAbe2/multiz8way/anno/maf>

foreach f (*.maf)
  echo -n "${f}: "
  mafFilter -overlap -minRow=1 $f > /dev/null
end

If there are 'rejected blocks', contact the developer.

Read both README files:

/goldenPath/ponAbe2/phastCons8way/README.txt
/goldenPath/ponAbe2/multiz8way/README.txt

Check upstream files to make sure that the species name doesn't appear in an "s" line:

[hgwdev:~/goldenPath/ponAbe2/multiz8way/maf> zcat upstream*.maf.gz | grep "s ponAbe2" | wc -l
0
If this is not zero, contact the developer.

Check upstream files to make sure gene names haven't been truncated (to 9 chars):

[hgwdev:~/goldenPath/ponAbe2/multiz8way/maf> zcat upstream*.maf.gz | head

##maf version=1 scoring=zero
a score=0.000000
s NM_001017434 0 1000 + 1000 GTGAAGTGTCAGGGTGGAGAAGCAAATACAAACTCTTCACTAAGTGGCCCT

If the gene names are short (9 characters) contact the developer.

Check one maf file:

[hgwdev:~/goldenPath/ponAbe2/multiz8way/maf> zcat chrX.maf.gz | head

##maf version=1 scoring=autoMZ.v1
a score=21236.000000
s ponAbe2.chrX     2 249 + 156195299 cagtggcatgatcacagatgactgcagcctcggcctccatagc

Read through both description pages:

• Conservation track:
  • Check image that displays on conservation details page.
  • Check "Gene tracks used for codon translation" table against make doc.
  • Make sure organsisms are listed (in all places) in the correct phylogenetic order.
  • Make sure that this page includes all the extra sections (if the multizs have been anotated).
  • Make sure there is a tree model available.
• Most Conserved track:
  • Make sure the text referrs to the correct species.

Check trackDb.ra file:

• Conservation track:
  • Make sure there is a speciesCodonDefault entry (usually is this species).
  • Make sure Jim has signed off on the species listed in the speciesDefaultOff entry.
• Most Conserved track:

Figure out extFile and seq tables:

• if they are standard maf files, there will be no entries in the seq table.
• There may be more than one set of entries in the extFile table. Make sure you only push the set that pertains to the actual files you are pushing to hgnfs1 (e.g. /gbdb/ponAbe2/multiz8way/anno/maf/*)
• These are the ones that will need pushing to beta:

mysql> select path from extFile where path like "%anno/maf%";

Test in the Genome Browser:

• Zoom out past 1M bps (this tests the multiz*waySummary table)
• Find example areas of all annotation types (check against the maf file for that location):
  • pale yellow bar
  • green square brackets
  • vertical blue bar
  • gaps
• Check out codon translation for a few species.

Test in the tables:

• joinerCheck

• featureBits

[hgwdev:~/qa/tracks/conservation/ponAbe2> nice featureBits ponAbe2 multiz8way gap -bed=output.bed 162920397 bases of 3093572278 (5.266%) in intersection

• countPerChrom.csh ponAbe2 multiz8way

• find out how phastCons was run (from make doc). See if the species listed in the non-inf list make sense. In this case, they do not add to the phastCons wiggle. --not-informative