Programmatic access to the Genome Browser

From genomewiki
Jump to navigationJump to search

The UCSC API for retrieving data and uploading data is RESTful over HTTP but does not use JSON to save computational time on the server. Download of most data formats requires client-side C tools that convert to/from binary files. Data upload uses custom text files.

Here are some common tasks that can be done from scripts with the UCSC Genome Browser. It is assumed that the reader knows the standard Unix command line tools.

Download data stored in a database table

  • use Tools - Table Browser - "Describe schema" to browse the database schema. All fields have a human readable description and the links to other tables are shown.
  • to access the public Mysql server, use a commen like mysql hg19 --no-defaults -h genome-mysql.cse.ucsc.edu -u genome -A -e 'select * from pubsBingBlat' -NB > out.txt
  • the list of data tracks is part of the table trackDb. The first column is the internal name of the track.
  • note the "type" field in the table trackDb. Our documentation of file formats at http://genome.ucsc.edu/FAQ/FAQformat.html explains the meaning of the different columns.
  • tracks with types that start with "big" are stored in binary files (see below), all others are stored at least to some extent in Mysql tables.
  • the first column in many tables with genomic coordinates is called "bin" and can be stripped for most applications
 mysql --no-defaults -h genome-mysql.cse.ucsc.edu -u genome -A -e "select ta
bleName, type, priority from trackDb where tableName in ('gold', 'refGene','knownGene', 'ccds', 'clinvar') limit 5"  hg19 
+-----------+-------------------------------------+----------+
| tableName | type                                | priority |
+-----------+-------------------------------------+----------+
| clinvar   | bigBed 12 .                         |      100 |
| gold      | bed 3 +                             |      100 |
| knownGene | genePred knownGenePep knownGeneMrna |        1 |
| refGene   | genePred refPep refMrna             |        2 |
+-----------+-------------------------------------+----------+

mysql --no-defaults -h genome-mysql.cse.ucsc.edu -u genome -A -e "select * from knownGene limit 3"  hg19 
+------------+-------+--------+---------+-------+----------+--------+-----------+--------------------+--------------------+-----------+------------+
| name       | chrom | strand | txStart | txEnd | cdsStart | cdsEnd | exonCount | exonStarts         | exonEnds           | proteinID | alignID    |
+------------+-------+--------+---------+-------+----------+--------+-----------+--------------------+--------------------+-----------+------------+
| uc001aaa.3 | chr1  | +      |   11873 | 14409 |    11873 |  11873 |         3 | 11873,12612,13220, | 12227,12721,14409, |           | uc001aaa.3 |
| uc010nxr.1 | chr1  | +      |   11873 | 14409 |    11873 |  11873 |         3 | 11873,12645,13220, | 12227,12697,14409, |           | uc010nxr.1 |
| uc010nxq.1 | chr1  | +      |   11873 | 14409 |    12189 |  13639 |         3 | 11873,12594,13402, | 12227,12721,14409, | B7ZGX9    | uc010nxq.1 |
+------------+-------+--------+---------+-------+----------+--------+-----------+--------------------+--------------------+-----------+------------+

Get the chromosome sequence for a range

twoBitToFa http://hgdownload.cse.ucsc.edu/gbdb/hg19/hg19.2bit stdout -seq=chr21 -start=15000000 -end=15000050
>chr21:15000000-15000050  
agccctgaacaaagacagggcttggcttatataggcaaacttacagaagc

Get the "wiggle" (x-y-plot) graph data for a chromosome range

bigWigToWig http://hgdownload.cse.ucsc.edu/gbdb/hg19/bbi/wgEncodeBroadHistoneK562Cbx2Sig.bigWig -chrom=chr21 -start=15000000 -end=15000200 stdout
variableStep chrom=chr21 span=25
15000026        0.92
15000051        1
15000076        1
15000101        1
15000126        1
15000151        1.24
15000176        2

Get a copy of the current Genome Browser image from a script

Upload a custom track and link to the genome browser with the track loaded