Emergency Backup BLAT Servers: Difference between revisions
mNo edit summary |
(→"mm10 blat is down!" Example for QA to follow when moving a down-blat-server assembly to emergency blatx: adding an example of returning hg38 to normal state.) |
||
(23 intermediate revisions by 6 users not shown) | |||
Line 1: | Line 1: | ||
===Overview=== | ===Overview=== | ||
In case certain blat servers go down, there is a a backup blat server ("blatx") that has ports pre-configured to host the "top 5" blatted assemblies (hg38, hg19, hg18, mm10, mm9). If the current blat server(s) hosting any of these 5 assemblies goes down, manually switch to the specified fail-over server in the list below by updating the hgcentral.blatServers table. A common solution is for the admins to restart the blat server that has gone down. | In case certain blat servers go down, there is a a backup blat server ("blatx") that has ports pre-configured to host the "top 5" blatted assemblies (hg38, hg19, hg18, mm10, mm9). If the current blat server(s) hosting any of these 5 assemblies goes down, manually switch to the specified fail-over server in the list below by updating the hgcentral.blatServers table. A common solution is for the admins to restart the blat server that has gone down. | ||
===List of current backup "blatx" | ===List of current backup "blatx" server ports=== | ||
'''NOTE this information could be outdated, be sure to check things work.''' | |||
; hg38 | |||
: host: blatx | |||
: trans port: 17786 ''isTrans=1, canPcr=0'' | |||
: untrans port: 17787 ''isTrans=0, canPcr=1'' | |||
; hg19 | |||
: host: blatx | |||
: trans port: 17778 ''isTrans=1, canPcr=0'' | |||
: untrans port: 17779 ''isTrans=0, canPcr=1'' | |||
; hg18 | |||
: host: blatx | |||
: trans port: 17782 ''isTrans=1, canPcr=0'' | |||
: untrans port: 17783 ''isTrans=0, canPcr=1'' | |||
; mm10 | |||
: host: blatx | |||
: trans port: 17780 ''isTrans=1, canPcr=0'' | |||
: untrans port: 17781 ''isTrans=0, canPcr=1'' | |||
; mm9 | |||
: host: blatx | |||
: trans port: 17784 ''isTrans=1, canPcr=0'' | |||
: untrans port: 17785 ''isTrans=0, canPcr=1'' | |||
==="mm10 blat is down!" Example=== | |||
; dm6 | |||
: host: blatx | |||
: trans port: 17874 ''isTrans=1, canPcr=0'' | |||
: untrans port: 17875 ''isTrans=0, canPcr=1' | |||
; dm3 | |||
: host: blatx | |||
: trans port: 17866 ''isTrans=1, canPcr=0'' | |||
: untrans port: 17867 ''isTrans=0, canPcr=1'' | |||
; rn6 | |||
: host: blatx | |||
: trans port: 17868 ''isTrans=1, canPcr=0'' | |||
: untrans port: 17869 ''isTrans=0, canPcr=1' | |||
; danRer11 | |||
: host: blatx | |||
: trans port: 17872 ''isTrans=1, canPcr=0'' | |||
: untrans port: 17873 ''isTrans=0, canPcr=1'' | |||
; danRer10 | |||
: host: blatx | |||
: trans port: 17870 ''isTrans=1, canPcr=0'' | |||
: untrans port: 17871 ''isTrans=0, canPcr=1'' | |||
; danRer7 | |||
: host: blatx | |||
: trans port: 17864 ''isTrans=1, canPcr=0'' | |||
: untrans port: 17865 ''isTrans=0, canPcr=1'' | |||
==="mm10 blat is down!" Example for QA to follow when moving a down-blat-server assembly to emergency blatx=== | |||
How is mm10 blat currently configured? | How is mm10 blat currently configured? | ||
Line 75: | Line 113: | ||
mm10 blat should now be fixed on the original blat server, be sure to go to the RR and do another blat test. | mm10 blat should now be fixed on the original blat server, be sure to go to the RR and do another blat test. | ||
====Example return of hg38 to normal state==== | |||
<pre> | |||
select * from blatServers where db='hg38'; | |||
update blatServers set host='blat1d', port=17902 where db='hg38' and isTrans=1; | |||
update blatServers set host='blat1d', port=17903 where db='hg38' and isTrans=0; | |||
</pre> | |||
By doing this directly (instead of with -e command) you can see a report like: | |||
::Query OK, '''1 row affected''' (0.00 sec) | |||
::'''Rows matched: 1 Changed: 1''' Warnings: 0 | |||
This is can comfort you to know you were only changing the row you meant to change. '''Note''' above ports may change. | |||
===Test with gfServer=== | |||
A quick command-line test example: | |||
<pre> | |||
gfClient blatx.soe.ucsc.edu 17845 /gbdb/strPur4/ test.fa dnaTestOut.psl | |||
</pre> | |||
===About gfServer logs=== | |||
As of 1/25/18: Haifang says: I just upgraded gfServer on blatx and added two new options, -debugLog -seqLog. [http://genomewiki.ucsc.edu/genecats/index.php/Monitoring_Tasks_Notes#check_that_blat_servers_are_running_ok See more about revieing gfServer.log here]. | |||
>ssh qateam@blatx.soe.ucsc.edu | |||
Chris Lee says: | |||
debugLog and seqLog are options on gfServer, not gfClient. You can see the additional lines in the gfServer logs on the blatx machine: | |||
<pre> | |||
[qateam@blatx.soe.ucsc.edu /home/qateam] tail -15 /scratch/strPur4/gfServer.log | |||
>query | |||
gcccagctaaaaccaatcaccttcaagggataaaggttcatccaaatatg | |||
taaaaaccgactgaagacagcttagttagaaacgtgtgtgggatcaacta | |||
tggcgttgccgttgactagatctagatccctacttttttttgttctcaat | |||
acggtatgtagcttggtatccgcctctgacaatgatcccagccctagctt | |||
ctgatcatgatctggcacaaaatcaatgtaggtctagatctagatctatc | |||
cgacttcgtaaacaacatagcctatttctttatcgttgaactatgagttt | |||
atgactaaaacattcttcttcttcttcttctt | |||
2018/01/25 09:58:52: debug: 1711519 101 clumps, 36593 hits | |||
2018/01/25 09:59:18: info: gfServer version 36x2 on host blat4d, port 17845 connection from 132.249.245.79 | |||
2018/01/25 09:59:18: warn: Zero sized query | |||
2018/01/25 10:00:12: info: gfServer version 36x2 on host blat4d, port 17845 connection from 132.249.245.79 | |||
2018/01/25 10:00:12: debug: 0ddf270562684f29pcr cctacattgattttgtgccagatcatgatcagaagctagggctgggatca gcccagctaaaaccaatcaccttcaagggataaaggttcatccaaat 4000 | |||
2018/01/25 10:00:12: debug: 1791616 PCR cctacattgattttgtgccagatcatgatcagaagctagggctgggatca gcccagctaaaaccaatcaccttcaagggataaaggttcatccaaat 63 clumps | |||
Compared to a gfServer running without those options, like on blat1a: | |||
[qateam@blat1a.soe.ucsc.edu /scratch/bosTau7] tail gfServer.log | |||
2018/01/25 07:24:13: info: gfServer version 34x12 on host blat1a, port 17845 connection from 128.114.119.132 | |||
2018/01/25 08:00:02: info: gfServer version 34x12 on host blat1a, port 17845 connection from 132.249.245.79 | |||
.... # more of the same | |||
</pre> | |||
(Note: 128.114.198.32 is the new hgwdev, in the above example 132.249.245.79 was the old hgwdev address) | |||
[[Category:Browser QA]] | [[Category:Browser QA]] | ||
===List of current original "blat1*" server ports=== | |||
See the hgcentral backups: | |||
https://genecats.gi.ucsc.edu/qa/test-results/hgcentral/ | |||
You can navigate to the blatServers table and see the history for the specific tables. |
Latest revision as of 22:01, 25 September 2020
Overview
In case certain blat servers go down, there is a a backup blat server ("blatx") that has ports pre-configured to host the "top 5" blatted assemblies (hg38, hg19, hg18, mm10, mm9). If the current blat server(s) hosting any of these 5 assemblies goes down, manually switch to the specified fail-over server in the list below by updating the hgcentral.blatServers table. A common solution is for the admins to restart the blat server that has gone down.
List of current backup "blatx" server ports
NOTE this information could be outdated, be sure to check things work.
- hg38
- host: blatx
- trans port: 17786 isTrans=1, canPcr=0
- untrans port: 17787 isTrans=0, canPcr=1
- hg19
- host: blatx
- trans port: 17778 isTrans=1, canPcr=0
- untrans port: 17779 isTrans=0, canPcr=1
- hg18
- host: blatx
- trans port: 17782 isTrans=1, canPcr=0
- untrans port: 17783 isTrans=0, canPcr=1
- mm10
- host: blatx
- trans port: 17780 isTrans=1, canPcr=0
- untrans port: 17781 isTrans=0, canPcr=1
- mm9
- host: blatx
- trans port: 17784 isTrans=1, canPcr=0
- untrans port: 17785 isTrans=0, canPcr=1
- dm6
- host: blatx
- trans port: 17874 isTrans=1, canPcr=0
- untrans port: 17875 isTrans=0, canPcr=1'
- dm3
- host: blatx
- trans port: 17866 isTrans=1, canPcr=0
- untrans port: 17867 isTrans=0, canPcr=1
- rn6
- host: blatx
- trans port: 17868 isTrans=1, canPcr=0
- untrans port: 17869 isTrans=0, canPcr=1'
- danRer11
- host: blatx
- trans port: 17872 isTrans=1, canPcr=0
- untrans port: 17873 isTrans=0, canPcr=1
- danRer10
- host: blatx
- trans port: 17870 isTrans=1, canPcr=0
- untrans port: 17871 isTrans=0, canPcr=1
- danRer7
- host: blatx
- trans port: 17864 isTrans=1, canPcr=0
- untrans port: 17865 isTrans=0, canPcr=1
"mm10 blat is down!" Example for QA to follow when moving a down-blat-server assembly to emergency blatx
How is mm10 blat currently configured?
hgsql -h genome-centdb -e "select * from blatServers where db='mm10'" hgcentral +------+--------+-------+---------+--------+ | db | host | port | isTrans | canPcr | +------+--------+-------+---------+--------+ | mm10 | blat1d | 17779 | 0 | 1 | | mm10 | blat1d | 17778 | 1 | 0 | +------+--------+-------+---------+--------+
Update the blatServers table to point mm10 to the backup "blatx" server:
hgsql -h genome-centdb -e "update blatServers set host='blatx' where db='mm10'" hgcentral hgsql -h genome-centdb -e "update blatServers set port='17780' where db='mm10' and isTrans='1'" hgcentral hgsql -h genome-centdb -e "update blatServers set port='17781' where db='mm10' and isTrans='0'" hgcentral
Check the change:
hgsql -h genome-centdb -e "select * from blatServers where db='mm10'" hgcentral +------+-------+-------+---------+--------+ | db | host | port | isTrans | canPcr | +------+-------+-------+---------+--------+ | mm10 | blatx | 17781 | 0 | 1 | | mm10 | blatx | 17780 | 1 | 0 | +------+-------+-------+---------+--------+
Mm10 blat should now be fixed (is on the emergency server), go to the RR and do a blat test to be sure.
When the failed blat server has been fixed, roll back to it. In this example, move mm10 from blatx back to blat1d:
hgsql -h genome-centdb -e "update blatServers set host='blat1d' where db='mm10'" hgcentral hgsql -h genome-centdb -e "update blatServers set port='17778' where db='mm10' and isTrans='1'" hgcentral hgsql -h genome-centdb -e "update blatServers set port='17779' where db='mm10' and isTrans='0'" hgcentral
mm10 blat should now be fixed on the original blat server, be sure to go to the RR and do another blat test.
Example return of hg38 to normal state
select * from blatServers where db='hg38'; update blatServers set host='blat1d', port=17902 where db='hg38' and isTrans=1; update blatServers set host='blat1d', port=17903 where db='hg38' and isTrans=0;
By doing this directly (instead of with -e command) you can see a report like:
- Query OK, 1 row affected (0.00 sec)
- Rows matched: 1 Changed: 1 Warnings: 0
This is can comfort you to know you were only changing the row you meant to change. Note above ports may change.
Test with gfServer
A quick command-line test example:
gfClient blatx.soe.ucsc.edu 17845 /gbdb/strPur4/ test.fa dnaTestOut.psl
About gfServer logs
As of 1/25/18: Haifang says: I just upgraded gfServer on blatx and added two new options, -debugLog -seqLog. See more about revieing gfServer.log here.
>ssh qateam@blatx.soe.ucsc.edu
Chris Lee says:
debugLog and seqLog are options on gfServer, not gfClient. You can see the additional lines in the gfServer logs on the blatx machine:
[qateam@blatx.soe.ucsc.edu /home/qateam] tail -15 /scratch/strPur4/gfServer.log >query gcccagctaaaaccaatcaccttcaagggataaaggttcatccaaatatg taaaaaccgactgaagacagcttagttagaaacgtgtgtgggatcaacta tggcgttgccgttgactagatctagatccctacttttttttgttctcaat acggtatgtagcttggtatccgcctctgacaatgatcccagccctagctt ctgatcatgatctggcacaaaatcaatgtaggtctagatctagatctatc cgacttcgtaaacaacatagcctatttctttatcgttgaactatgagttt atgactaaaacattcttcttcttcttcttctt 2018/01/25 09:58:52: debug: 1711519 101 clumps, 36593 hits 2018/01/25 09:59:18: info: gfServer version 36x2 on host blat4d, port 17845 connection from 132.249.245.79 2018/01/25 09:59:18: warn: Zero sized query 2018/01/25 10:00:12: info: gfServer version 36x2 on host blat4d, port 17845 connection from 132.249.245.79 2018/01/25 10:00:12: debug: 0ddf270562684f29pcr cctacattgattttgtgccagatcatgatcagaagctagggctgggatca gcccagctaaaaccaatcaccttcaagggataaaggttcatccaaat 4000 2018/01/25 10:00:12: debug: 1791616 PCR cctacattgattttgtgccagatcatgatcagaagctagggctgggatca gcccagctaaaaccaatcaccttcaagggataaaggttcatccaaat 63 clumps Compared to a gfServer running without those options, like on blat1a: [qateam@blat1a.soe.ucsc.edu /scratch/bosTau7] tail gfServer.log 2018/01/25 07:24:13: info: gfServer version 34x12 on host blat1a, port 17845 connection from 128.114.119.132 2018/01/25 08:00:02: info: gfServer version 34x12 on host blat1a, port 17845 connection from 132.249.245.79 .... # more of the same
(Note: 128.114.198.32 is the new hgwdev, in the above example 132.249.245.79 was the old hgwdev address)
List of current original "blat1*" server ports
See the hgcentral backups: https://genecats.gi.ucsc.edu/qa/test-results/hgcentral/
You can navigate to the blatServers table and see the history for the specific tables.