SECIS comparative genomics: Difference between revisions

From genomewiki
Jump to navigationJump to search
Line 14: Line 14:
=== Embedded frame browser: work in progress to build frame navigator for SECIS elements ===
=== Embedded frame browser: work in progress to build frame navigator for SECIS elements ===
     <table border cellpadding="2">
     <table border cellpadding="2">
      <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser SEPP1a]</tr>
<tr><td><http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr1:54149214-54149304&pix=900&Submit=submit&hgsid=108664512 +DIO1</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser SEPP1b]</tr>
       <tr><td>http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr14:79733861-79733960&pix=900&Submit=submit&hgsid=108664512 -DIO2]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser SEPN]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr14:101099071-101099164&pix=900&Submit=submit&hgsid=108664512 +DIO3]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser SEPHS2]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr3:49369691-49369785&pix=900&Submit=submit&hgsid=108664512 -GPX1]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser SELM1]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr14:64475664-64475758&pix=900&Submit=submit&hgsid=108664512 -GPX2]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser MSRB1]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr5:150388518-150388612&pix=900&Submit=submit&hgsid=108664512 +GPX3]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser TXNRD1]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr19:1057606-1057699&pix=900&Submit=submit&hgsid=108664512 +GPX4]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser TXNRD3]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr6:28579354-28579447&pix=900&Submit=submit&hgsid=108664512 -GPX6]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser TXNRD2]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr16:1928560-1928655&pix=900&Submit=submit&hgsid=108664512 -MSRB1]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser SELS]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr11:57266912-57266997&pix=900&Submit=submit&hgsid=108664512 +SELH]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser SELT]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr2:26466729-26466827&pix=900&Submit=submit&hgsid=108664512 +SELI]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser SELO]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr3:53894412-53894514&pix=900&Submit=submit&hgsid=108664512 -SELK]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser SELV]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr1:87101071-87101170&pix=900&Submit=submit&hgsid=108664512 -SELM1]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser SELH]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr22:48998024-48998125&pix=900&Submit=submit&hgsid=108664512 +SELO]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser SEPP2]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr15:99630065-99630164&pix=900&Submit=submit&hgsid=108664512 -SELS]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser SELI]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr3:151828145-151828239&pix=900&Submit=submit&hgsid=108664512 +SELT]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser SELK]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr19:44702609-44702705&pix=900&Submit=submit&hgsid=108664512 +SELV]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser GPX3]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr16:30362559-30362656&pix=900&Submit=submit&hgsid=108664512 -SEPHS2]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser GPX6]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr1:26015877-26015962&pix=900&Submit=submit&hgsid=108664512 +SEPN]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser GPX1]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr5:42836241-42836339&pix=900&Submit=submit&hgsid=108664512 -SEPP1a]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser GPX2]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr19:52979371-52979466&pix=900&Submit=submit&hgsid=108664512 +SEPW]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser GPX4]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr12:103266545-103266640&pix=900&Submit=submit&hgsid=108664512 +TXNRD1]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser SEPW]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr22:18243070-18243167&pix=900&Submit=submit&hgsid=108664512 -TXNRD2]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser DIO1]</tr>
       <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr3:127809148-127809242&pix=900&Submit=submit&hgsid=108664512 -TXNRD3]</tr>
      <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser DIO2]</tr>
      <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser DIO3]</tr>
      <tr><td>[http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chrX%3A151%2C073%2C054-151%2C383%2C976&pix=900&Submit=submit&hgsid=108664512target=browser SELM2]</tr>
     </table>
     </table>



Revision as of 17:57, 16 June 2008

Embedded active browsers displaying SECIS elements

Embedded browser1

<embedurl> http://hgwdev.cse.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=Tomemerald&hgS_otherUserSessionName=DIO1 {scrolling=auto}{width=1250}{height=500} </embedurl>

Embedded browser2

<embedurl> http://hgwdev.cse.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=Tomemerald&hgS_otherUserSessionName=boreoSECIS {scrolling=auto}{width=1250}{height=300} </embedurl>

Embedded frame browser: work in progress to build frame navigator for SECIS elements

<http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr1:54149214-54149304&pix=900&Submit=submit&hgsid=108664512 +DIO1
http://genome.cse.ucsc.edu/cgi-bin/hgTracks?hgsid=108664512&clade=vertebrate&org=Human&db=hg18&position=chr14:79733861-79733960&pix=900&Submit=submit&hgsid=108664512 -DIO2]
+DIO3
-GPX1
-GPX2
+GPX3
+GPX4
-GPX6
-MSRB1
+SELH
+SELI
-SELK
-SELM1
+SELO
-SELS
+SELT
+SELV
-SEPHS2
+SEPN
-SEPP1a
+SEPW
+TXNRD1
-TXNRD2
-TXNRD3

Underlying data for the SECIS track

Blat queries by block for custom SECIS track

>SEPP1a_left
ttttctttttccagtgttctatttgctttaatgag
>SEPP1b_left
tatattgcttagtaagtatttccatagtcaatgat
>SEPN_left
cagtggcttccccggcagcagccccatgat
>SEPHS2_left
acctgcaaccatctgacttggtctctgttaatgac
>SELM1_left
agagtgaaacattcacaaagatttgcgttaatgaa
>MSRB1_left
cctgccagccgccctggccctggtcactgcatgat
>TXNRD1_left
atttggcagggcatcgaagggatgcatccatgaa
>TXNRD3_left
gacagcgagaagcagtgggactgcttccttgac
>TXNRD2_left
cacccccccccaggctcctggtgccagatgatgac
>SELS_left
taggacagtctctgtgacaggttgcgttgaatgat
>SELT_left
gatcattgcaagagcagcgtgactgacattatgaa
>SELO_left
ctgccctggcccatgcacacccgtctttccatgat
>SELV_left
tttctctcccatcttaggagtctcagctggatgat
>SELH_left
tttgtgtccctggtgatgttggaacattaatgat
>SELI_left
tttcactgaatgaagtttgtgcttgaatgaa
>SELK_left
acaaggactgctctgtgtcctcacagatgaatgag
>GPX3_left
cacggaccccatggcaggggtggcgtcttcatgag
>GPX6_left
cccacctcacatgaagggaagggcatctccatgat
>GPX1_left
tgctgtctcgggggggttttcatctatgag
>GPX2_left
agacttgggtaagctctgggccttcacagaatgat
>GPX4_left
ccacgcccttggagccttccaccggcactcatgac
>SEPW_left
gacccagcccctctcagcagacgcttcatgat
>DIO1_left
ttttaactctgtgtctttacatatttgtttatgat
>DIO2_left
cagagatgtgcagagttgaccagtgtgcggatgat
>DIO3_left
ttgggtgcacaggagccccactgctgatgac

>SEPP1a_mid
ttttctttttccagtgttctatttgctttaatgagaatagaaacgtaa
>SEPP1b_mid
tatattgcttagtaagtatttccatagtcaatgatggtttaataggtaa
>SEPN_mid
cagtggcttccccggcagcagccccatgatggctgaatccgaa
>SEPHS2_mid
acctgcaaccatctgacttggtctctgttaatgacgtctctccctctaa
>SELM1_mid
agagtgaaacattcacaaagatttgcgttaatgaagactacacagaaa
>MSRB1_mid
cctgccagccgccctggccctggtcactgcatgatccgctctggtcaa
>TXNRD1_mid
atttggcagggcatcgaagggatgcatccatgaagtcaccagtctcaa
>TXNRD3_mid
gacagcgagaagcagtgggactgcttccttgacgccttagcttgg
>TXNRD2_mid
cacccccccccaggctcctggtgccagatgatgacgacctgggtggaa
>SELS_mid
taggacagtctctgtgacaggttgcgttgaatgatgtcttccttatcaa
>SELT_mid
gatcattgcaagagcagcgtgactgacattatgaaggcctgtactgaa
>SELO_mid
ctgccctggcccatgcacacccgtctttccatgatggcagagacatcc
>SELV_mid
tttctctcccatcttaggagtctcagctggatgatgagaagggctgaa
>SELH_mid
tttgtgtccctggtgatgttggaacattaatgatggaacatggccaa
>SELI_mid
tttcactgaatgaagtttgtgcttgaatgaagagtgtatcttaaa
>SELK_mid
acaaggactgctctgtgtcctcacagatgaatgaggtcatgctgggaa
>GPX3_mid
cacggaccccatggcaggggtggcgtcttcatgagggaggggcccaaa
>GPX6_mid
cccacctcacatgaagggaagggcatctccatgatggtggatcccaa
>GPX1_mid
tgctgtctcgggggggttttcatctatgagggtgtttcctctaa
>GPX2_mid
agacttgggtaagctctgggccttcacagaatgatggcaccttcctaa
>GPX4_mid
ccacgcccttggagccttccaccggcactcatgacggcctgcctgca
>SEPW_mid
gacccagcccctctcagcagacgcttcatgataggaaggactgaa
>DIO1_mid
ttttaactctgtgtctttacatatttgtttatgatggccacagcctaa
>DIO2_mid
cagagatgtgcagagttgaccagtgtgcggatgataactactgacgaa
>DIO3_mid
ttgggtgcacaggagccccactgctgatgacgaactatctctaa

>SEPP1a_tool1
ttttctttttccagtgttctatttgctttaatgagaatagaaacgtaaactatgacctaggggtttctgttggataattagcagtttagaatggaggaa
>SEPP1b_tool1
tatattgcttagtaagtatttccatagtcaatgatggtttaataggtaaaccaaaccctataaacctgacctcctttatggttaatact
>SEPN_tool1
cagtggcttccccggcagcagccccatgatggctgaatccgaaatcctcgatgggtccagcttgatgtctttgcagctgcacctat
>SEPHS2_tool1
acctgcaaccatctgacttggtctctgttaatgacgtctctccctctaaaccccattaaggactgggagaggcagagcaagcctcagagcccaggcct
>SELM1_tool1
agagtgaaacattcacaaagatttgcgttaatgaagactacacagaaaacctttctagggatttgtgtggatcagatacatacttggcaaatttttgagt
>MSRB1_tool1
cctgccagccgccctggccctggtcactgcatgatccgctctggtcaaacccttccaggccagccagagtggggatggtctgtgacctgctgggaa
>TXNRD1_tool1
atttggcagggcatcgaagggatgcatccatgaagtcaccagtctcaagcccatgtggtaggcggtgatggaacaactgtcaaatcagttttagca
>TXNRD3_tool1
gacagcgagaagcagtgggactgcttccttgacgccttagcttggagccccgttatgaggtgagccaaggctgactctcgcaagccaggactgag
>TXNRD2_tool1
cacccccccccaggctcctggtgccagatgatgacgacctgggtggaaacctaccctgtgggcacccatgtccgagccccctggcatttctgcaatgc
>SELS_tool1
taggacagtctctgtgacaggttgcgttgaatgatgtcttccttatcaatggtgagcccaccagtgaggattactgatgtggacagttgatggggtttgt
>SELT_tool1
gatcattgcaagagcagcgtgactgacattatgaaggcctgtactgaagacagcaagctgttagtacagaccagatgctttcttggcaggctcgt
>SELO_tool1
ctgccctggcccatgcacacccgtctttccatgatggcagagacatccagtcaggacctgacccgtctctgtctgaggccggctcagcagtgcagcctggtc
>SELV_tool1
tttctctcccatcttaggagtctcagctggatgatgagaagggctgaaatgttgccaagtcaggtccttttctgatggtggctggggctggggtgag
>SELH_tool1
tttgtgtccctggtgatgttggaacattaatgatggaacatggccaaacttcagtcatgatcctgaagccatggtttcttccctgc
>SELI_tool1
tttcactgaatgaagtttgtgcttgaatgaagagtgtatcttaaaccccctttttttggacaggctgcacttggataaaataggcaccactgtgttgat
>SELK_tool1
acaaggactgctctgtgtcctcacagatgaatgaggtcatgctgggaattccctctgcagggaactggcctgactgacatgcagttccataaatgcagatgtt
>GPX3_tool1
cacggaccccatggcaggggtggcgtcttcatgagggaggggcccaaagcccttgtgggcggacctcccctgagcctgtctgaggggccagccct
>GPX6_tool1
cccacctcacatgaagggaagggcatctccatgatggtggatcccaaaacccctctgggtcgcaccctgccagagccttccttggtgcctgtcc
>GPX1_tool1
tgctgtctcgggggggttttcatctatgagggtgtttcctctaaacctacgagggaggaacacctgatcttacagaaaataccacctcgagatgg
>GPX2_tool1
agacttgggtaagctctgggccttcacagaatgatggcaccttcctaaaccctcatgggtggtgtctgagaggcgtgaagggcctggagccactc
>GPX4_tool1
ccacgcccttggagccttccaccggcactcatgacggcctgcctgcaaacctgctggtggggcagacccgaaaatccagcgtgcaccccgccgg
>SEPW_tool1
gacccagcccctctcagcagacgcttcatgataggaaggactgaaaagtcttgtggacacctggtctttccctgatgttctcgtggctgctgttgg
>DIO1_tool1
ttttaactctgtgtctttacatatttgtttatgatggccacagcctaaagtacacacggctgtgacttgattcaaaagaaaatgttataag
>DIO2_tool1
cagagatgtgcagagttgaccagtgtgcggatgataactactgacgaaagagtcatcgactcagttagtggttggatgtagtcacattagtttgcctctc
>DIO3_tool1
ttgggtgcacaggagccccactgctgatgacgaactatctctaactggtcttgaccacgagctagttctgaattgcaggggcctcaaagcagca

>SEPP1a_right
ttttctttttccagtgttctatttgctttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat
>SEPP1b_right
tatattgcttagtaagtatttccatagtcaatgatggtttaataggtaaaccaaaccctataaacctgac
>SEPN_right
cagtggcttccccggcagcagccccatgatggctgaatccgaaatcctcgatgggtccagcttgat
>SEPHS2_right
acctgcaaccatctgacttggtctctgttaatgacgtctctccctctaaaccccattaaggactgggagaggcagag
>SELM1_right
agagtgaaacattcacaaagatttgcgttaatgaagactacacagaaaacctttctagggatttgtgtggatcagat
>MSRB1_right
cctgccagccgccctggccctggtcactgcatgatccgctctggtcaaacccttccaggccagccagagtggggat
>TXNRD1_right
atttggcagggcatcgaagggatgcatccatgaagtcaccagtctcaagcccatgtggtaggcggtgatggaa
>TXNRD3_right
gacagcgagaagcagtgggactgcttccttgacgccttagcttggagccccgttatgaggtgagccaaggctgac
>TXNRD2_right
cacccccccccaggctcctggtgccagatgatgacgacctgggtggaaacctaccctgtgggcacccatgtccgag
>SELS_right
taggacagtctctgtgacaggttgcgttgaatgatgtcttccttatcaatggtgagcccaccagtgaggattactgat
>SELT_right
gatcattgcaagagcagcgtgactgacattatgaaggcctgtactgaagacagcaagctgttagtacagaccagat
>SELO_right
ctgccctggcccatgcacacccgtctttccatgatggcagagacatccagtcaggacctgacccgtctctgtctgag
>SELV_right
tttctctcccatcttaggagtctcagctggatgatgagaagggctgaaatgttgccaagtcaggtccttttctgat
>SELH_right
tttgtgtccctggtgatgttggaacattaatgatggaacatggccaaacttcagtcatgatcctgaa
>SELI_right
tttcactgaatgaagtttgtgcttgaatgaagagtgtatcttaaaccccctttttttggacaggctgcacttggat
>SELK_right
acaaggactgctctgtgtcctcacagatgaatgaggtcatgctgggaattccctctgcagggaactggcctgactgac
>GPX3_right
cacggaccccatggcaggggtggcgtcttcatgagggaggggcccaaagcccttgtgggcggacctcccctgag
>GPX6_right
cccacctcacatgaagggaagggcatctccatgatggtggatcccaaaacccctctgggtcgcaccctgccagag
>GPX1_right
tgctgtctcgggggggttttcatctatgagggtgtttcctctaaacctacgagggaggaacacctgat
>GPX2_right
agacttgggtaagctctgggccttcacagaatgatggcaccttcctaaaccctcatgggtggtgtctgag
>GPX4_right
ccacgcccttggagccttccaccggcactcatgacggcctgcctgcaaacctgctggtggggcagacccgaa
>SEPW_right
gacccagcccctctcagcagacgcttcatgataggaaggactgaaaagtcttgtggacacctggtctttccctgat
>DIO1_right
ttttaactctgtgtctttacatatttgtttatgatggccacagcctaaagtacacacggctgtgacttgat
>DIO2_right
cagagatgtgcagagttgaccagtgtgcggatgataactactgacgaaagagtcatcgactcagttagtggttggat
>DIO3_right
ttgggtgcacaggagccccactgctgatgacgaactatctctaactggtcttgaccacgagctagttctgaa

>SEPP1a_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgg
>SEPP1b_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttct
>SEPN_alex
ttgctttaatgagaatagaaacgtaaactatgacctaggggt
>SEPHS2_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat
>SELM1_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat
>MSRB1_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga
>TXNRD1_alex
tttaatgagaatagaaacgtaaactatgacctaggggtttctgtt
>TXNRD3_alex
ctttaatgagaatagaaacgtaaactatgacctaggggtttctgttgg
>TXNRD2_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga
>SELS_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggata
>SELT_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga
>SELO_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat
>SELV_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga
>SELH_alex
tttaatgagaatagaaacgtaaactatgacctaggggtt
>SELI_alex
tgctttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga
>SELK_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggata
>GPX3_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttg
>GPX6_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgg
>GPX1_alex
ttgctttaatgagaatagaaacgtaaactatgacctaggggttt
>GPX2_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttct
>GPX4_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgt
>SEPW_alex
gctttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga
>DIO1_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctg
>DIO2_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat
>DIO3_alex
tgctttaatgagaatagaaacgtaaactatgacctaggggtttctgt

Blat queries by gene for custom SECIS track

>SEPP1a_left
ttttctttttccagtgttctatttgctttaatgag
>SEPP1a_mid
ttttctttttccagtgttctatttgctttaatgagaatagaaacgtaa
>SEPP1a_tool1
ttttctttttccagtgttctatttgctttaatgagaatagaaacgtaaactatgacctaggggtttctgttggataattagcagtttagaatggaggaa
>SEPP1a_right
ttttctttttccagtgttctatttgctttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat
>SEPP1a_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgg

>SEPP1b_left
tatattgcttagtaagtatttccatagtcaatgat
>SEPP1b_mid
tatattgcttagtaagtatttccatagtcaatgatggtttaataggtaa
>SEPP1b_tool1
tatattgcttagtaagtatttccatagtcaatgatggtttaataggtaaaccaaaccctataaacctgacctcctttatggttaatact
>SEPP1b_right
tatattgcttagtaagtatttccatagtcaatgatggtttaataggtaaaccaaaccctataaacctgac
>SEPP1b_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttct

>SEPN_left
cagtggcttccccggcagcagccccatgat
>SEPN_mid
cagtggcttccccggcagcagccccatgatggctgaatccgaa
>SEPN_tool1
cagtggcttccccggcagcagccccatgatggctgaatccgaaatcctcgatgggtccagcttgatgtctttgcagctgcacctat
>SEPN_right
cagtggcttccccggcagcagccccatgatggctgaatccgaaatcctcgatgggtccagcttgat
>SEPN_alex
ttgctttaatgagaatagaaacgtaaactatgacctaggggt

>SEPHS2_left
acctgcaaccatctgacttggtctctgttaatgac
>SEPHS2_mid
acctgcaaccatctgacttggtctctgttaatgacgtctctccctctaa
>SEPHS2_tool1
acctgcaaccatctgacttggtctctgttaatgacgtctctccctctaaaccccattaaggactgggagaggcagagcaagcctcagagcccaggcct
>SEPHS2_right
acctgcaaccatctgacttggtctctgttaatgacgtctctccctctaaaccccattaaggactgggagaggcagag
>SEPHS2_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat

>SELM1_left
agagtgaaacattcacaaagatttgcgttaatgaa
>SELM1_mid
agagtgaaacattcacaaagatttgcgttaatgaagactacacagaaa
>SELM1_tool1
agagtgaaacattcacaaagatttgcgttaatgaagactacacagaaaacctttctagggatttgtgtggatcagatacatacttggcaaatttttgagt
>SELM1_right
agagtgaaacattcacaaagatttgcgttaatgaagactacacagaaaacctttctagggatttgtgtggatcagat
>SELM1_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat

>MSRB1_left
cctgccagccgccctggccctggtcactgcatgat
>MSRB1_mid
cctgccagccgccctggccctggtcactgcatgatccgctctggtcaa
>MSRB1_tool1
cctgccagccgccctggccctggtcactgcatgatccgctctggtcaaacccttccaggccagccagagtggggatggtctgtgacctgctgggaa
>MSRB1_right
cctgccagccgccctggccctggtcactgcatgatccgctctggtcaaacccttccaggccagccagagtggggat
>MSRB1_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga

>TXNRD1_left
atttggcagggcatcgaagggatgcatccatgaa
>TXNRD1_mid
atttggcagggcatcgaagggatgcatccatgaagtcaccagtctcaa
>TXNRD1_tool1
atttggcagggcatcgaagggatgcatccatgaagtcaccagtctcaagcccatgtggtaggcggtgatggaacaactgtcaaatcagttttagca
>TXNRD1_right
atttggcagggcatcgaagggatgcatccatgaagtcaccagtctcaagcccatgtggtaggcggtgatggaa
>TXNRD1_alex
tttaatgagaatagaaacgtaaactatgacctaggggtttctgtt

>TXNRD3_left
gacagcgagaagcagtgggactgcttccttgac
>TXNRD3_mid
gacagcgagaagcagtgggactgcttccttgacgccttagcttgg
>TXNRD3_tool1
gacagcgagaagcagtgggactgcttccttgacgccttagcttggagccccgttatgaggtgagccaaggctgactctcgcaagccaggactgag
>TXNRD3_right
gacagcgagaagcagtgggactgcttccttgacgccttagcttggagccccgttatgaggtgagccaaggctgac
>TXNRD3_alex
ctttaatgagaatagaaacgtaaactatgacctaggggtttctgttgg

>TXNRD2_left
cacccccccccaggctcctggtgccagatgatgac
>TXNRD2_mid
cacccccccccaggctcctggtgccagatgatgacgacctgggtggaa
>TXNRD2_tool1
cacccccccccaggctcctggtgccagatgatgacgacctgggtggaaacctaccctgtgggcacccatgtccgagccccctggcatttctgcaatgc
>TXNRD2_right
cacccccccccaggctcctggtgccagatgatgacgacctgggtggaaacctaccctgtgggcacccatgtccgag
>TXNRD2_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga

>SELS_left
taggacagtctctgtgacaggttgcgttgaatgat
>SELS_mid
taggacagtctctgtgacaggttgcgttgaatgatgtcttccttatcaa
>SELS_tool1
taggacagtctctgtgacaggttgcgttgaatgatgtcttccttatcaatggtgagcccaccagtgaggattactgatgtggacagttgatggggtttgt
>SELS_right
taggacagtctctgtgacaggttgcgttgaatgatgtcttccttatcaatggtgagcccaccagtgaggattactgat
>SELS_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggata

>SELT_left
gatcattgcaagagcagcgtgactgacattatgaa
>SELT_mid
gatcattgcaagagcagcgtgactgacattatgaaggcctgtactgaa
>SELT_tool1
gatcattgcaagagcagcgtgactgacattatgaaggcctgtactgaagacagcaagctgttagtacagaccagatgctttcttggcaggctcgt
>SELT_right
gatcattgcaagagcagcgtgactgacattatgaaggcctgtactgaagacagcaagctgttagtacagaccagat
>SELT_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga

>SELO_left
ctgccctggcccatgcacacccgtctttccatgat
>SELO_mid
ctgccctggcccatgcacacccgtctttccatgatggcagagacatcc
>SELO_tool1
ctgccctggcccatgcacacccgtctttccatgatggcagagacatccagtcaggacctgacccgtctctgtctgaggccggctcagcagtgcagcctggtc
>SELO_right
ctgccctggcccatgcacacccgtctttccatgatggcagagacatccagtcaggacctgacccgtctctgtctgag
>SELO_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat

>SELV_left
tttctctcccatcttaggagtctcagctggatgat
>SELV_mid
tttctctcccatcttaggagtctcagctggatgatgagaagggctgaa
>SELV_tool1
tttctctcccatcttaggagtctcagctggatgatgagaagggctgaaatgttgccaagtcaggtccttttctgatggtggctggggctggggtgag
>SELV_right
tttctctcccatcttaggagtctcagctggatgatgagaagggctgaaatgttgccaagtcaggtccttttctgat
>SELV_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga

>SELH_left
tttgtgtccctggtgatgttggaacattaatgat
>SELH_mid
tttgtgtccctggtgatgttggaacattaatgatggaacatggccaa
>SELH_tool1
tttgtgtccctggtgatgttggaacattaatgatggaacatggccaaacttcagtcatgatcctgaagccatggtttcttccctgc
>SELH_right
tttgtgtccctggtgatgttggaacattaatgatggaacatggccaaacttcagtcatgatcctgaa
>SELH_alex
tttaatgagaatagaaacgtaaactatgacctaggggtt

>SELI_left
tttcactgaatgaagtttgtgcttgaatgaa
>SELI_mid
tttcactgaatgaagtttgtgcttgaatgaagagtgtatcttaaa
>SELI_tool1
tttcactgaatgaagtttgtgcttgaatgaagagtgtatcttaaaccccctttttttggacaggctgcacttggataaaataggcaccactgtgttgat
>SELI_right
tttcactgaatgaagtttgtgcttgaatgaagagtgtatcttaaaccccctttttttggacaggctgcacttggat
>SELI_alex
tgctttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga

>SELK_left
acaaggactgctctgtgtcctcacagatgaatgag
>SELK_mid
acaaggactgctctgtgtcctcacagatgaatgaggtcatgctgggaa
>SELK_tool1
acaaggactgctctgtgtcctcacagatgaatgaggtcatgctgggaattccctctgcagggaactggcctgactgacatgcagttccataaatgcagatgtt
>SELK_right
acaaggactgctctgtgtcctcacagatgaatgaggtcatgctgggaattccctctgcagggaactggcctgactgac
>SELK_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggata

>GPX3_left
cacggaccccatggcaggggtggcgtcttcatgag
>GPX3_mid
cacggaccccatggcaggggtggcgtcttcatgagggaggggcccaaa
>GPX3_tool1
cacggaccccatggcaggggtggcgtcttcatgagggaggggcccaaagcccttgtgggcggacctcccctgagcctgtctgaggggccagccct
>GPX3_right
cacggaccccatggcaggggtggcgtcttcatgagggaggggcccaaagcccttgtgggcggacctcccctgag
>GPX3_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttg

>GPX6_left
cccacctcacatgaagggaagggcatctccatgat
>GPX6_mid
cccacctcacatgaagggaagggcatctccatgatggtggatcccaa
>GPX6_tool1
cccacctcacatgaagggaagggcatctccatgatggtggatcccaaaacccctctgggtcgcaccctgccagagccttccttggtgcctgtcc
>GPX6_right
cccacctcacatgaagggaagggcatctccatgatggtggatcccaaaacccctctgggtcgcaccctgccagag
>GPX6_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttgg

>GPX1_left
tgctgtctcgggggggttttcatctatgag
>GPX1_mid
tgctgtctcgggggggttttcatctatgagggtgtttcctctaa
>GPX1_tool1
tgctgtctcgggggggttttcatctatgagggtgtttcctctaaacctacgagggaggaacacctgatcttacagaaaataccacctcgagatgg
>GPX1_right
tgctgtctcgggggggttttcatctatgagggtgtttcctctaaacctacgagggaggaacacctgat
>GPX1_alex
ttgctttaatgagaatagaaacgtaaactatgacctaggggttt

>GPX2_left
agacttgggtaagctctgggccttcacagaatgat
>GPX2_mid
agacttgggtaagctctgggccttcacagaatgatggcaccttcctaa
>GPX2_tool1
agacttgggtaagctctgggccttcacagaatgatggcaccttcctaaaccctcatgggtggtgtctgagaggcgtgaagggcctggagccactc
>GPX2_right
agacttgggtaagctctgggccttcacagaatgatggcaccttcctaaaccctcatgggtggtgtctgag
>GPX2_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttct

>GPX4_left
ccacgcccttggagccttccaccggcactcatgac
>GPX4_mid
ccacgcccttggagccttccaccggcactcatgacggcctgcctgca
>GPX4_tool1
ccacgcccttggagccttccaccggcactcatgacggcctgcctgcaaacctgctggtggggcagacccgaaaatccagcgtgcaccccgccgg
>GPX4_right
ccacgcccttggagccttccaccggcactcatgacggcctgcctgcaaacctgctggtggggcagacccgaa
>GPX4_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgt

>SEPW_left
gacccagcccctctcagcagacgcttcatgat
>SEPW_mid
gacccagcccctctcagcagacgcttcatgataggaaggactgaa
>SEPW_tool1
gacccagcccctctcagcagacgcttcatgataggaaggactgaaaagtcttgtggacacctggtctttccctgatgttctcgtggctgctgttgg
>SEPW_right
gacccagcccctctcagcagacgcttcatgataggaaggactgaaaagtcttgtggacacctggtctttccctgat
>SEPW_alex
gctttaatgagaatagaaacgtaaactatgacctaggggtttctgttgga

>DIO1_left
ttttaactctgtgtctttacatatttgtttatgat
>DIO1_mid
ttttaactctgtgtctttacatatttgtttatgatggccacagcctaa
>DIO1_tool1
ttttaactctgtgtctttacatatttgtttatgatggccacagcctaaagtacacacggctgtgacttgattcaaaagaaaatgttataag
>DIO1_right
ttttaactctgtgtctttacatatttgtttatgatggccacagcctaaagtacacacggctgtgacttgat
>DIO1_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctg

>DIO2_left
cagagatgtgcagagttgaccagtgtgcggatgat
>DIO2_mid
cagagatgtgcagagttgaccagtgtgcggatgataactactgacgaa
>DIO2_tool1
cagagatgtgcagagttgaccagtgtgcggatgataactactgacgaaagagtcatcgactcagttagtggttggatgtagtcacattagtttgcctctc
>DIO2_right
cagagatgtgcagagttgaccagtgtgcggatgataactactgacgaaagagtcatcgactcagttagtggttggat
>DIO2_alex
ttaatgagaatagaaacgtaaactatgacctaggggtttctgttggat

>DIO3_left
ttgggtgcacaggagccccactgctgatgac
>DIO3_mid
ttgggtgcacaggagccccactgctgatgacgaactatctctaa
>DIO3_tool1
ttgggtgcacaggagccccactgctgatgacgaactatctctaactggtcttgaccacgagctagttctgaattgcaggggcctcaaagcagca
>DIO3_right
ttgggtgcacaggagccccactgctgatgacgaactatctctaactggtcttgaccacgagctagttctgaa
>DIO3_alex
tgctttaatgagaatagaaacgtaaactatgacctaggggtttctgt

PSL data that generate SECIS custom track

35	0	0	0	0	0	0	0	+	DIO1_left	35	0	35	chr1	247249719	54149213	54149248	1	35,	0,	54149213,
35	0	0	0	0	0	0	0	-	DIO2_left	35	0	35	chr14	106368585	79733925	79733960	1	35,	0,	79733925,
31	0	0	0	0	0	0	0	+	DIO3_left	31	0	31	chr14	106368585	101099070	101099101	1	31,	0,	101099070,
30	0	0	0	0	0	0	0	-	GPX1_left	30	0	30	chr3	199501827	49369755	49369785	1	30,	0,	49369755,
24	0	0	0	0	0	1	50	+	GPX2_left	35	0	24	chr21	46944323	17088438	17088512	2	6,18,	0,6,	17088438,17088494,
35	0	0	0	0	0	0	0	+	GPX3_left	35	0	35	chr5	180857866	150388517	150388552	1	35,	0,	150388517,
35	0	0	0	0	0	0	0	+	GPX4_left	35	0	35	chr19	63811651	1057605	1057640	1	35,	0,	1057605,
35	0	0	0	0	0	0	0	-	GPX6_left	35	0	35	chr6	170899992	28579412	28579447	1	35,	0,	28579412,
35	0	0	0	0	0	0	0	-	MSRB1_left	35	0	35	chr16	88827254	1928620	1928655	1	35,	0,	1928620,
34	0	0	0	0	0	0	0	+	SELH_left	34	0	34	chr11	134452384	57266911	57266945	1	34,	0,	57266911,
31	0	0	0	0	0	0	0	+	SELI_left	31	0	31	chr2	242951149	26466728	26466759	1	31,	0,	26466728,
34	1	0	0	0	0	0	0	-	SELK_left	35	0	35	chr19	63811651	42875879	42875914	1	35,	0,	42875879,
35	0	0	0	0	0	0	0	-	SELM1_left	35	0	35	chr1	247249719	87101135	87101170	1	35,	0,	87101135,
35	0	0	0	0	0	0	0	+	SELO_left	35	0	35	chr22	49691432	48998023	48998058	1	35,	0,	48998023,
35	0	0	0	0	0	0	0	-	SELS_left	35	0	35	chr15	100338915	99630129	99630164	1	35,	0,	99630129,
35	0	0	0	0	0	0	0	+	SELT_left	35	0	35	chr3	199501827	151828144	151828179	1	35,	0,	151828144,
35	0	0	0	0	0	0	0	+	SELV_left	35	0	35	chr19	63811651	44702608	44702643	1	35,	0,	44702608,
35	0	0	0	0	0	0	0	-	SEPHS2_left	35	0	35	chr16	88827254	30362621	30362656	1	35,	0,	30362621,
30	0	0	0	0	0	0	0	+	SEPN_left	30	0	30	chr1	247249719	26015876	26015906	1	30,	0,	26015876,
35	0	0	0	0	0	0	0	-	SEPP1a_left	35	0	35	chr5	180857866	42836304	42836339	1	35,	0,	42836304,
35	0	0	0	0	0	0	0	-	SEPP1b_left	35	0	35	chr5	180857866	42835869	42835904	1	35,	0,	42835869,
32	0	0	0	0	0	0	0	+	SEPW_left	32	0	32	chr19	63811651	52979370	52979402	1	32,	0,	52979370,
34	0	0	0	0	0	0	0	+	TXNRD1_left	34	0	34	chr12	132349534	103266544	103266578	1	34,	0,	103266544,
25	0	0	0	0	0	1	280	+	TXNRD2_left	35	0	25	chr2	242951149	96918346	96918651	2	9,16,	0,9,	96918346,96918635,
33	0	0	0	0	0	0	0	-	TXNRD3_left	33	0	33	chr3	199501827	127809209	127809242	1	33,	0,	127809209,
49	0	0	0	0	0	0	0	-	SELS_mid	49	0	49	chr15	100338915	99630115	99630164	1	49,	0,	99630115,
49	0	0	0	0	0	0	0	-	SEPHS2_mid	49	0	49	chr16	88827254	30362607	30362656	1	49,	0,	30362607,
49	0	0	0	0	0	0	0	-	SEPP1b_mid	49	0	49	chr5	180857866	42835855	42835904	1	49,	0,	42835855,
48	0	0	0	0	0	0	0	-	DIO2_mid	48	0	48	chr14	106368585	79733912	79733960	1	48,	0,	79733912,
48	0	0	0	0	0	0	0	+	DIO1_mid	48	0	48	chr1	247249719	54149213	54149261	1	48,	0,	54149213,
48	0	0	0	0	0	0	0	-	GPX2_mid	48	0	48	chr14	106368585	64475710	64475758	1	48,	0,	64475710,
48	0	0	0	0	0	0	0	+	GPX3_mid	48	0	48	chr5	180857866	150388517	150388565	1	48,	0,	150388517,
48	0	0	0	0	0	0	0	-	SELK_mid	48	0	48	chr3	199501827	53894466	53894514	1	48,	0,	53894466,
48	0	0	0	0	0	0	0	+	SELV_mid	48	0	48	chr19	63811651	44702608	44702656	1	48,	0,	44702608,
48	0	0	0	0	0	0	0	+	SELO_mid	48	0	48	chr22	49691432	48998023	48998071	1	48,	0,	48998023,
48	0	0	0	0	0	0	0	+	SELT_mid	48	0	48	chr3	199501827	151828144	151828192	1	48,	0,	151828144,
48	0	0	0	0	0	0	0	-	TXNRD2_mid	48	0	48	chr22	49691432	18243119	18243167	1	48,	0,	18243119,
48	0	0	0	0	0	0	0	+	TXNRD1_mid	48	0	48	chr12	132349534	103266544	103266592	1	48,	0,	103266544,
48	0	0	0	0	0	0	0	-	MSRB1_mid	48	0	48	chr16	88827254	1928607	1928655	1	48,	0,	1928607,
48	0	0	0	0	0	0	0	-	SELM1_mid	48	0	48	chr1	247249719	87101122	87101170	1	48,	0,	87101122,
48	0	0	0	0	0	0	0	-	SEPP1a_mid	48	0	48	chr5	180857866	42836291	42836339	1	48,	0,	42836291,
47	0	0	0	0	0	0	0	+	GPX4_mid	47	0	47	chr19	63811651	1057605	1057652	1	47,	0,	1057605,
47	0	0	0	0	0	0	0	-	GPX6_mid	47	0	47	chr6	170899992	28579400	28579447	1	47,	0,	28579400,
47	0	0	0	0	0	0	0	+	SELH_mid	47	0	47	chr11	134452384	57266911	57266958	1	47,	0,	57266911,
45	0	0	0	0	0	0	0	+	SEPW_mid	45	0	45	chr19	63811651	52979370	52979415	1	45,	0,	52979370,
46	1	0	0	0	0	0	0	-	SELK_mid	48	0	47	chr19	63811651	42875867	42875914	1	47,	1,	42875867,
45	0	0	0	0	0	0	0	+	SELI_mid	45	0	45	chr2	242951149	26466728	26466773	1	45,	0,	26466728,
45	0	0	0	0	0	0	0	-	TXNRD3_mid	45	0	45	chr3	199501827	127809197	127809242	1	45,	0,	127809197,
44	0	0	0	0	0	0	0	+	DIO3_mid	44	0	44	chr14	106368585	101099070	101099114	1	44,	0,	101099070,
44	0	0	0	0	0	0	0	-	GPX1_mid	44	0	44	chr3	199501827	49369741	49369785	1	44,	0,	49369741,
46	2	0	0	0	0	0	0	+	SELT_mid	48	0	48	chr9	140273252	6269196	6269244	1	48,	0,	6269196,
43	0	0	0	0	0	0	0	+	SEPN_mid	43	0	43	chr1	247249719	26015876	26015919	1	43,	0,	26015876,
43	1	0	0	0	0	1	1	-	GPX1_mid	44	0	44	chrX	154913754	13306693	13306738	2	39,5,	0,39,	13306693,13306733,
42	1	0	0	0	0	1	1	-	GPX1_mid	44	1	44	chr21	46944323	27437452	27437496	2	39,4,	0,39,	27437452,27437492,
43	5	0	0	0	0	0	0	+	SELM1_mid	48	0	48	chr14	106368585	67166253	67166301	1	48,	0,	67166253,
37	0	0	0	0	0	0	0	-	SELK_mid	48	11	48	chr7	158821424	84315225	84315262	1	37,	0,	84315225,
38	3	0	0	0	0	0	0	+	SEPHS2_mid	49	8	49	chr15	100338915	74570339	74570380	1	41,	8,	74570339,
36	1	0	0	1	11	1	9	-	SELK_mid	48	0	48	chr19	63811651	10237164	10237210	2	21,16,	0,32,	10237164,10237194,
31	0	0	0	1	1	2	13	+	GPX2_mid	48	11	43	chr13	114142980	38566319	38566363	3	19,7,5,	11,31,38,	38566319,38566349,38566358,
28	1	0	0	1	6	1	15	-	DIO1_mid	48	13	48	chr5	180857866	61745707	61745751	2	11,18,	0,17,	61745707,61745733,
26	0	0	0	0	0	1	19	+	SELO_mid	48	18	44	chr8	146274826	129396647	129396692	2	11,15,	18,29,	129396647,129396677,
25	0	0	0	0	0	1	280	+	TXNRD2_mid	48	0	25	chr2	242951149	96918346	96918651	2	9,16,	0,9,	96918346,96918635,
24	0	0	0	0	0	1	50	+	GPX2_mid	48	0	24	chr21	46944323	17088438	17088512	2	6,18,	0,6,	17088438,17088494,
25	0	0	0	1	6	1	1	-	SEPP1a_mid	48	11	42	chr8	146274826	120166374	120166400	2	19,6,	6,31,	120166374,120166394,
24	0	0	0	0	0	1	1	+	SEPP1a_mid	48	5	29	chr12	132349534	109866604	109866629	2	20,4,	5,25,	109866604,109866625,
22	1	0	0	0	0	0	0	-	DIO3_mid	44	2	25	chr10	135374737	6117099	6117122	1	23,	19,	6117099,
21	1	0	0	0	0	0	0	+	SEPW_mid	45	23	45	chr17	78774742	38842389	38842411	1	22,	23,	38842389,
20	0	0	0	0	0	0	0	-	SELO_mid	48	1	21	chr7	158821424	132098648	132098668	1	20,	27,	132098648,
20	0	0	0	0	0	0	0	+	SELO_mid	48	27	47	chr12	132349534	70427659	70427679	1	20,	27,	70427659,
20	0	0	0	0	0	0	0	-	SEPP1a_mid	48	12	32	chr1	247249719	225373102	225373122	1	20,	16,	225373102,
103	0	0	0	0	0	0	0	-	SELK_tool1	103	0	103	chr3	199501827	53894411	53894514	1	103,	0,	53894411,
102	0	0	0	0	0	0	0	+	SELO_tool1	102	0	102	chr22	49691432	48998023	48998125	1	102,	0,	48998023,
100	0	0	0	0	0	0	0	-	DIO2_tool1	100	0	100	chr14	106368585	79733860	79733960	1	100,	0,	79733860,
100	0	0	0	0	0	0	0	-	SELS_tool1	100	0	100	chr15	100338915	99630064	99630164	1	100,	0,	99630064,
100	0	0	0	0	0	0	0	-	SELM1_tool1	100	0	100	chr1	247249719	87101070	87101170	1	100,	0,	87101070,
99	0	0	0	0	0	0	0	+	SELI_tool1	99	0	99	chr2	242951149	26466728	26466827	1	99,	0,	26466728,
99	0	0	0	0	0	0	0	-	SEPP1a_tool1	99	0	99	chr5	180857866	42836240	42836339	1	99,	0,	42836240,
98	0	0	0	0	0	0	0	-	TXNRD2_tool1	98	0	98	chr22	49691432	18243069	18243167	1	98,	0,	18243069,
98	0	0	0	0	0	0	0	-	SEPHS2_tool1	98	0	98	chr16	88827254	30362558	30362656	1	98,	0,	30362558,
97	0	0	0	0	0	0	0	+	SELV_tool1	97	0	97	chr19	63811651	44702608	44702705	1	97,	0,	44702608,
96	0	0	0	0	0	0	0	+	SEPW_tool1	96	0	96	chr19	63811651	52979370	52979466	1	96,	0,	52979370,
96	0	0	0	0	0	0	0	+	TXNRD1_tool1	96	0	96	chr12	132349534	103266544	103266640	1	96,	0,	103266544,
96	0	0	0	0	0	0	0	-	MSRB1_tool1	96	0	96	chr16	88827254	1928559	1928655	1	96,	0,	1928559,
95	0	0	0	0	0	0	0	-	GPX2_tool1	95	0	95	chr14	106368585	64475663	64475758	1	95,	0,	64475663,
95	0	0	0	0	0	0	0	-	GPX1_tool1	95	0	95	chr3	199501827	49369690	49369785	1	95,	0,	49369690,
95	0	0	0	0	0	0	0	+	GPX3_tool1	95	0	95	chr5	180857866	150388517	150388612	1	95,	0,	150388517,
95	0	0	0	0	0	0	0	+	SELT_tool1	95	0	95	chr3	199501827	151828144	151828239	1	95,	0,	151828144,
95	0	0	0	0	0	0	0	-	TXNRD3_tool1	95	0	95	chr3	199501827	127809147	127809242	1	95,	0,	127809147,
94	0	0	0	0	0	0	0	+	DIO3_tool1	94	0	94	chr14	106368585	101099070	101099164	1	94,	0,	101099070,
94	0	0	0	0	0	0	0	+	GPX4_tool1	94	0	94	chr19	63811651	1057605	1057699	1	94,	0,	1057605,
94	0	0	0	0	0	0	0	-	GPX6_tool1	94	0	94	chr6	170899992	28579353	28579447	1	94,	0,	28579353,
91	0	0	0	0	0	0	0	+	DIO1_tool1	91	0	91	chr1	247249719	54149213	54149304	1	91,	0,	54149213,
93	4	0	0	0	0	0	0	-	SELK_tool1	103	0	97	chr19	63811651	42875817	42875914	1	97,	6,	42875817,
89	0	0	0	0	0	0	0	-	SEPP1b_tool1	89	0	89	chr5	180857866	42835815	42835904	1	89,	0,	42835815,
91	4	0	0	0	0	1	1	-	GPX1_tool1	95	0	95	chrX	154913754	13306642	13306738	2	90,5,	0,90,	13306642,13306733,
86	0	0	0	0	0	0	0	+	SELH_tool1	86	0	86	chr11	134452384	57266911	57266997	1	86,	0,	57266911,
86	0	0	0	0	0	0	0	+	SEPN_tool1	86	0	86	chr1	247249719	26015876	26015962	1	86,	0,	26015876,
89	3	0	0	1	1	0	0	-	SELK_tool1	103	4	97	chr6	170899992	132182428	132182520	2	28,64,	6,35,	132182428,132182456,
92	8	0	0	0	0	0	0	+	SELM1_tool1	100	0	100	chr14	106368585	67166253	67166353	1	100,	0,	67166253,
82	1	0	0	0	0	0	0	-	SELK_tool1	103	11	94	chr7	158821424	84315179	84315262	1	83,	9,	84315179,
86	3	0	0	1	5	2	5	-	GPX1_tool1	95	1	95	chr21	46944323	27437402	27437496	3	42,43,4,	0,47,90,	27437402,27437448,27437492,
87	9	0	0	1	1	0	0	+	SELK_tool1	103	0	97	chr6	170899992	119211098	119211194	2	69,27,	0,70,	119211098,119211167,
80	4	0	0	0	0	0	0	+	SELT_tool1	95	0	84	chr9	140273252	6269196	6269280	1	84,	0,	6269196,
82	9	0	0	1	7	0	0	+	SEPHS2_tool1	98	0	98	chr5	180857866	15015120	15015211	2	20,71,	0,27,	15015120,15015140,
80	4	0	0	3	13	2	14	-	SELK_tool1	103	0	97	chr19	63811651	10237112	10237210	4	9,23,36,16,	6,16,40,87,	10237112,10237126,10237149,10237194,
80	10	0	0	0	0	0	0	+	SEPHS2_tool1	98	8	98	chr15	100338915	74570339	74570429	1	90,	8,	74570339,
31	0	0	0	1	1	2	13	+	GPX2_tool1	95	11	43	chr13	114142980	38566319	38566363	3	19,7,5,	11,31,38,	38566319,38566349,38566358,
29	0	0	0	0	0	2	8	+	SELH_tool1	86	46	75	chr2	242951149	71587400	71587437	3	9,3,17,	46,55,58,	71587400,71587415,71587420,
27	0	0	0	0	0	1	461	+	SELV_tool1	97	70	97	chr5	180857866	76323311	76323799	2	22,5,	70,92,	76323311,76323794,
26	0	0	0	1	2	0	0	+	GPX3_tool1	95	40	68	chr10	135374737	3081106	3081132	2	5,21,	40,47,	3081106,3081111,
26	0	0	0	0	0	1	19	+	SELO_tool1	102	18	44	chr8	146274826	129396647	129396692	2	11,15,	18,29,	129396647,129396677,
26	0	0	0	1	3	1	19	-	SEPW_tool1	96	47	76	chrX	154913754	149844331	149844376	2	9,17,	20,32,	149844331,149844359,
25	0	0	0	1	6	0	0	+	SELI_tool1	99	50	81	chr8	146274826	59646157	59646182	2	19,6,	50,75,	59646157,59646176,
25	0	0	0	0	0	1	364	+	SELH_tool1	86	61	86	chr16	88827254	17192425	17192814	2	16,9,	61,77,	17192425,17192805,
25	0	0	0	0	0	1	280	+	TXNRD2_tool1	98	0	25	chr2	242951149	96918346	96918651	2	9,16,	0,9,	96918346,96918635,
26	2	0	0	0	0	0	0	+	SEPHS2_tool1	98	59	87	chr2	242951149	3030319	3030347	1	28,	59,	3030319,
24	0	0	0	0	0	1	50	+	GPX2_tool1	95	0	24	chr21	46944323	17088438	17088512	2	6,18,	0,6,	17088438,17088494,
25	0	0	0	1	6	1	1	-	SEPP1a_tool1	99	11	42	chr8	146274826	120166374	120166400	2	19,6,	57,82,	120166374,120166394,
24	0	0	0	0	0	1	1	+	SEPP1a_tool1	99	5	29	chr12	132349534	109866604	109866629	2	20,4,	5,25,	109866604,109866625,
23	1	0	0	0	0	0	0	+	SEPW_tool1	96	23	47	chr17	78774742	38842389	38842413	1	24,	23,	38842389,
22	0	0	0	0	0	0	0	-	SELM1_tool1	100	71	93	chr10	135374737	95402789	95402811	1	22,	7,	95402789,
23	0	0	0	0	0	1	5	+	SEPP1b_tool1	89	30	53	chr8	146274826	107648419	107648447	2	17,6,	30,47,	107648419,107648441,
21	0	0	0	0	0	0	0	-	SELV_tool1	97	73	94	chr3	199501827	132624985	132625006	1	21,	3,	132624985,
21	0	0	0	0	0	0	0	-	SEPHS2_tool1	98	58	79	chr21	46944323	45665269	45665290	1	21,	19,	45665269,
22	0	0	0	0	0	1	1	+	SEPP1a_tool1	99	69	91	chr9	140273252	3941728	3941751	2	4,18,	69,73,	3941728,3941733,
20	0	0	0	0	0	0	0	-	DIO2_tool1	100	62	82	chr3	199501827	11771130	11771150	1	20,	18,	11771130,
20	0	0	0	0	0	0	0	-	SEPW_tool1	96	61	81	chr15	100338915	75994315	75994335	1	20,	15,	75994315,
20	0	0	0	0	0	0	0	-	SEPW_tool1	96	61	81	chr15	100338915	72150038	72150058	1	20,	15,	72150038,
20	0	0	0	0	0	0	0	+	SEPW_tool1	96	61	81	chr15	100338915	73349835	73349855	1	20,	61,	73349835,
20	0	0	0	0	0	0	0	+	SEPW_tool1	96	61	81	chr15	100338915	73374114	73374134	1	20,	61,	73374114,
20	0	0	0	0	0	0	0	+	SEPW_tool1	96	61	81	chr15	100338915	70745981	70746001	1	20,	61,	70745981,
20	0	0	0	0	0	0	0	+	GPX6_tool1	94	62	82	chr2	242951149	127577589	127577609	1	20,	62,	127577589,
20	0	0	0	0	0	0	0	-	SELI_tool1	99	50	70	chr4	191273063	144776923	144776943	1	20,	29,	144776923,
20	0	0	0	0	0	0	0	-	SELO_tool1	102	1	21	chr7	158821424	132098648	132098668	1	20,	81,	132098648,
20	0	0	0	0	0	0	0	+	SELO_tool1	102	27	47	chr12	132349534	70427659	70427679	1	20,	27,	70427659,
20	0	0	0	0	0	0	0	+	SELT_tool1	95	62	82	chr20	62435964	39921840	39921860	1	20,	62,	39921840,
20	0	0	0	0	0	0	0	+	MSRB1_tool1	96	75	95	chr3	199501827	190025059	190025079	1	20,	75,	190025059,
20	0	0	0	0	0	0	0	-	SEPP1b_tool1	89	41	61	chr17	78774742	50700873	50700893	1	20,	28,	50700873,
20	0	0	0	0	0	0	0	+	SEPP1b_tool1	89	34	54	chr10	135374737	13298866	13298886	1	20,	34,	13298866,
20	0	0	0	0	0	0	0	-	SEPP1a_tool1	99	12	32	chr1	247249719	225373102	225373122	1	20,	67,	225373102,
78	0	0	0	0	0	0	0	-	SELK_right	78	0	78	chr3	199501827	53894436	53894514	1	78,	0,	53894436,
78	0	0	0	0	0	0	0	-	SELS_right	78	0	78	chr15	100338915	99630086	99630164	1	78,	0,	99630086,
77	0	0	0	0	0	0	0	-	DIO2_right	77	0	77	chr14	106368585	79733883	79733960	1	77,	0,	79733883,
77	0	0	0	0	0	0	0	+	SELO_right	77	0	77	chr22	49691432	48998023	48998100	1	77,	0,	48998023,
77	0	0	0	0	0	0	0	-	SELM1_right	77	0	77	chr1	247249719	87101093	87101170	1	77,	0,	87101093,
77	0	0	0	0	0	0	0	-	SEPHS2_right	77	0	77	chr16	88827254	30362579	30362656	1	77,	0,	30362579,
76	0	0	0	0	0	0	0	+	SEPW_right	76	0	76	chr19	63811651	52979370	52979446	1	76,	0,	52979370,
76	0	0	0	0	0	0	0	+	SELI_right	76	0	76	chr2	242951149	26466728	26466804	1	76,	0,	26466728,
76	0	0	0	0	0	0	0	+	SELV_right	76	0	76	chr19	63811651	44702608	44702684	1	76,	0,	44702608,
76	0	0	0	0	0	0	0	+	SELT_right	76	0	76	chr3	199501827	151828144	151828220	1	76,	0,	151828144,
76	0	0	0	0	0	0	0	-	TXNRD2_right	76	0	76	chr22	49691432	18243091	18243167	1	76,	0,	18243091,
76	0	0	0	0	0	0	0	-	MSRB1_right	76	0	76	chr16	88827254	1928579	1928655	1	76,	0,	1928579,
75	0	0	0	0	0	0	0	-	GPX6_right	75	0	75	chr6	170899992	28579372	28579447	1	75,	0,	28579372,
75	0	0	0	0	0	0	0	-	TXNRD3_right	75	0	75	chr3	199501827	127809167	127809242	1	75,	0,	127809167,
75	0	0	0	0	0	0	0	-	SEPP1a_right	75	0	75	chr5	180857866	42836264	42836339	1	75,	0,	42836264,
74	0	0	0	0	0	0	0	+	GPX3_right	74	0	74	chr5	180857866	150388517	150388591	1	74,	0,	150388517,
73	0	0	0	0	0	0	0	+	TXNRD1_right	73	0	73	chr12	132349534	103266544	103266617	1	73,	0,	103266544,
72	0	0	0	0	0	0	0	+	DIO3_right	72	0	72	chr14	106368585	101099070	101099142	1	72,	0,	101099070,
72	0	0	0	0	0	0	0	+	GPX4_right	72	0	72	chr19	63811651	1057605	1057677	1	72,	0,	1057605,
75	3	0	0	0	0	0	0	-	SELK_right	78	0	78	chr19	63811651	42875836	42875914	1	78,	0,	42875836,
71	0	0	0	0	0	0	0	+	DIO1_right	71	0	71	chr1	247249719	54149213	54149284	1	71,	0,	54149213,
70	0	0	0	0	0	0	0	-	GPX2_right	70	0	70	chr14	106368585	64475688	64475758	1	70,	0,	64475688,
70	0	0	0	0	0	0	0	-	SEPP1b_right	70	0	70	chr5	180857866	42835834	42835904	1	70,	0,	42835834,
68	0	0	0	0	0	0	0	-	GPX1_right	68	0	68	chr3	199501827	49369717	49369785	1	68,	0,	49369717,
71	2	0	0	1	1	0	0	-	SELK_right	78	4	78	chr6	170899992	132182447	132182520	2	8,65,	0,9,	132182447,132182455,
72	4	0	0	0	0	0	0	+	SELT_right	76	0	76	chr9	140273252	6269196	6269272	1	76,	0,	6269196,
67	0	0	0	0	0	0	0	+	SELH_right	67	0	67	chr11	134452384	57266911	57266978	1	67,	0,	57266911,
66	0	0	0	0	0	0	0	+	SEPN_right	66	0	66	chr1	247249719	26015876	26015942	1	66,	0,	26015876,
66	1	0	0	0	0	0	0	-	SELK_right	78	11	78	chr7	158821424	84315195	84315262	1	67,	0,	84315195,
66	2	0	0	0	0	1	1	-	GPX1_right	68	0	68	chrX	154913754	13306669	13306738	2	63,5,	0,63,	13306669,13306733,
70	7	0	0	0	0	0	0	+	SELM1_right	77	0	77	chr14	106368585	67166253	67166330	1	77,	0,	67166253,
65	4	0	0	1	7	0	0	+	SEPHS2_right	77	0	76	chr5	180857866	15015120	15015189	2	20,49,	0,27,	15015120,15015140,
61	1	0	0	1	5	2	5	-	GPX1_right	68	1	68	chr21	46944323	27437429	27437496	3	15,43,4,	0,20,63,	27437429,27437448,27437492,
63	6	0	0	0	0	0	0	+	SELK_right	78	0	69	chr6	170899992	119211098	119211167	1	69,	0,	119211098,
63	6	0	0	0	0	0	0	+	SEPHS2_right	77	8	77	chr15	100338915	74570339	74570408	1	69,	8,	74570339,
60	2	0	0	2	12	1	9	-	SELK_right	78	0	74	chr19	63811651	10237139	10237210	3	10,36,16,	4,15,62,	10237139,10237149,10237194,
31	0	0	0	1	1	2	13	+	GPX2_right	70	11	43	chr13	114142980	38566319	38566363	3	19,7,5,	11,31,38,	38566319,38566349,38566358,
26	0	0	0	1	2	0	0	+	GPX3_right	74	40	68	chr10	135374737	3081106	3081132	2	5,21,	40,47,	3081106,3081111,
26	0	0	0	0	0	1	19	+	SELO_right	77	18	44	chr8	146274826	129396647	129396692	2	11,15,	18,29,	129396647,129396677,
26	0	0	0	1	3	1	19	-	SEPW_right	76	47	76	chrX	154913754	149844331	149844376	2	9,17,	0,12,	149844331,149844359,
25	0	0	0	0	0	1	280	+	TXNRD2_right	76	0	25	chr2	242951149	96918346	96918651	2	9,16,	0,9,	96918346,96918635,
24	0	0	0	0	0	1	50	+	GPX2_right	70	0	24	chr21	46944323	17088438	17088512	2	6,18,	0,6,	17088438,17088494,
24	0	0	0	0	0	1	1	+	SEPP1a_right	75	5	29	chr12	132349534	109866604	109866629	2	20,4,	5,25,	109866604,109866625,
23	1	0	0	0	0	0	0	+	SEPW_right	76	23	47	chr17	78774742	38842389	38842413	1	24,	23,	38842389,
23	0	0	0	0	0	1	5	+	SEPP1b_right	70	30	53	chr8	146274826	107648419	107648447	2	17,6,	30,47,	107648419,107648441,
22	0	0	0	0	0	1	1	-	MSRB1_right	76	53	75	chr20	62435964	55444749	55444772	2	5,17,	1,6,	55444749,55444755,
20	0	0	0	0	0	0	0	-	SELI_right	76	50	70	chr4	191273063	144776923	144776943	1	20,	6,	144776923,
20	0	0	0	0	0	0	0	-	SELO_right	77	1	21	chr7	158821424	132098648	132098668	1	20,	56,	132098648,
20	0	0	0	0	0	0	0	+	SELO_right	77	27	47	chr12	132349534	70427659	70427679	1	20,	27,	70427659,
20	0	0	0	0	0	0	0	-	SEPP1b_right	70	41	61	chr17	78774742	50700873	50700893	1	20,	9,	50700873,
20	0	0	0	0	0	0	0	+	SEPP1b_right	70	34	54	chr10	135374737	13298866	13298886	1	20,	34,	13298866,
20	0	0	0	0	0	0	0	-	SEPP1a_right	75	12	32	chr1	247249719	225373102	225373122	1	20,	43,	225373102,
51	0	0	0	0	0	0	0	-	SELI_alex	51	0	51	chr5	180857866	42836265	42836316	1	51,	0,	42836265,
50	0	0	0	0	0	0	0	-	SEPW_alex	50	0	50	chr5	180857866	42836265	42836315	1	50,	0,	42836265,
49	0	0	0	0	0	0	0	-	SELK_alex	49	0	49	chr5	180857866	42836263	42836312	1	49,	0,	42836263,
49	0	0	0	0	0	0	0	-	SELS_alex	49	0	49	chr5	180857866	42836263	42836312	1	49,	0,	42836263,
48	0	0	0	0	0	0	0	-	DIO2_alex	48	0	48	chr5	180857866	42836264	42836312	1	48,	0,	42836264,
48	0	0	0	0	0	0	0	-	SELO_alex	48	0	48	chr5	180857866	42836264	42836312	1	48,	0,	42836264,
48	0	0	0	0	0	0	0	-	TXNRD3_alex	48	0	48	chr5	180857866	42836266	42836314	1	48,	0,	42836266,
48	0	0	0	0	0	0	0	-	SELM1_alex	48	0	48	chr5	180857866	42836264	42836312	1	48,	0,	42836264,
48	0	0	0	0	0	0	0	-	SEPHS2_alex	48	0	48	chr5	180857866	42836264	42836312	1	48,	0,	42836264,
47	0	0	0	0	0	0	0	-	DIO3_alex	47	0	47	chr5	180857866	42836269	42836316	1	47,	0,	42836269,
47	0	0	0	0	0	0	0	-	SELV_alex	47	0	47	chr5	180857866	42836265	42836312	1	47,	0,	42836265,
47	0	0	0	0	0	0	0	-	SELT_alex	47	0	47	chr5	180857866	42836265	42836312	1	47,	0,	42836265,
47	0	0	0	0	0	0	0	-	TXNRD2_alex	47	0	47	chr5	180857866	42836265	42836312	1	47,	0,	42836265,
47	0	0	0	0	0	0	0	-	MSRB1_alex	47	0	47	chr5	180857866	42836265	42836312	1	47,	0,	42836265,
46	0	0	0	0	0	0	0	-	GPX6_alex	46	0	46	chr5	180857866	42836266	42836312	1	46,	0,	42836266,
46	0	0	0	0	0	0	0	-	SEPP1a_alex	46	0	46	chr5	180857866	42836266	42836312	1	46,	0,	42836266,
45	0	0	0	0	0	0	0	-	GPX3_alex	45	0	45	chr5	180857866	42836267	42836312	1	45,	0,	42836267,
45	0	0	0	0	0	0	0	-	TXNRD1_alex	45	0	45	chr5	180857866	42836268	42836313	1	45,	0,	42836268,
44	0	0	0	0	0	0	0	-	GPX1_alex	44	0	44	chr5	180857866	42836273	42836317	1	44,	0,	42836273,
43	0	0	0	0	0	0	0	-	GPX4_alex	43	0	43	chr5	180857866	42836269	42836312	1	43,	0,	42836269,
42	0	0	0	0	0	0	0	-	DIO1_alex	42	0	42	chr5	180857866	42836270	42836312	1	42,	0,	42836270,
42	0	0	0	0	0	0	0	-	SEPN_alex	42	0	42	chr5	180857866	42836275	42836317	1	42,	0,	42836275,
41	0	0	0	0	0	0	0	-	GPX2_alex	41	0	41	chr5	180857866	42836271	42836312	1	41,	0,	42836271,
41	0	0	0	0	0	0	0	-	SEPP1b_alex	41	0	41	chr5	180857866	42836271	42836312	1	41,	0,	42836271,
39	0	0	0	0	0	0	0	-	SELH_alex	39	0	39	chr5	180857866	42836274	42836313	1	39,	0,	42836274,
21	1	0	0	0	0	0	0	-	GPX1_alex	44	0	22	chrX	154913754	74223907	74223929	1	22,	22,	74223907,
21	1	0	0	0	0	0	0	-	SEPN_alex	42	0	22	chrX	154913754	74223907	74223929	1	22,	20,	74223907,

PSL data that generate boreoeutherian custom track

	
84	7	0	0	0	0	0	0	+	DIO1_tool1	91	0	91	chr1	169519511	40171838	40171929	1	91,	0,	40171838,
92	4	0	0	0	0	0	0	-	DIO2_tool1	100	4	100	chr14	126455928	105764192	105764288	1	96,	0,	105764192,
88	6	0	0	0	0	0	0	+	DIO3_tool1	94	0	94	chr14	126455928	123303991	123304085	1	94,	0,	123303991,
87	5	0	0	0	0	0	0	-	GPX2_tool1	95	0	92	chr14	126455928	93515719	93515811	1	92,	3,	93515719,
85	4	0	0	0	0	0	0	+	GPX3_tool1	95	6	95	chr5	135438014	111596045	111596134	1	89,	6,	111596045,
85	7	0	0	0	0	3	6	+	GPX4_tool1	94	2	94	chr19	11836958	494587	494685	4	21,31,35,5,	2,23,54,89,	494587,494609,494644,494680,
88	6	0	0	0	0	0	0	-	GPX6_tool1	94	0	94	chr6	128772084	22570259	22570353	1	94,	0,	22570259,
68	4	0	0	0	0	0	0	-	MSRB1_tool1	96	22	94	chr16a	21784349	1375915	1375987	1	72,	2,	1375915,
74	5	0	0	0	0	0	0	+	SELH_tool1	86	4	83	chr11	100778330	88371632	88371711	1	79,	4,	88371632,
95	4	0	0	0	0	0	0	+	SELI_tool1	99	0	99	chr2a	83993180	21144892	21144991	1	99,	0,	21144892,
91	4	0	0	1	5	1	1	-	SELM1_tool1	100	0	100	chr1	169519511	66580051	66580147	2	17,78,	0,22,	66580051,66580069,
91	4	0	0	1	5	1	1	+	SELM1_tool1	100	0	100	chr14	126455928	95588814	95588910	2	78,17,	0,83,	95588814,95588893,
70	3	0	0	0	0	0	0	+	SELO_tool1	102	20	93	chr12a	94328666	93913600	93913673	1	73,	20,	93913600,
98	2	0	0	0	0	0	0	+	SELS_tool1	100	0	100	chr14	126455928	6005591	6005691	1	100,	0,	6005591,
90	7	0	0	0	0	0	0	-	SELS_tool1	100	0	97	chr14	126455928	3441919	3442016	1	97,	3,	3441919,
95	0	0	0	0	0	1	93	-	SELT_tool1	95	0	95	chr3	176510875	97714857	97715045	2	90,5,	0,90,	97714857,97715040,
88	2	0	0	0	0	0	0	+	SELT_tool1	95	5	95	chr9	83807521	22270311	22270401	1	90,	5,	22270311,
86	4	0	0	0	0	0	0	+	SELV_tool1	97	7	97	chr16b	53486001	42050779	42050869	1	90,	7,	42050779,
94	4	0	0	0	0	0	0	+	SEPHS2_tool1	98	0	98	chr5	135438014	12044148	12044246	1	98,	0,	12044148,
93	5	0	0	0	0	0	0	-	SEPHS2_tool1	98	0	98	chr16a	21784349	21020047	21020145	1	98,	0,	21020047,
83	3	0	0	0	0	0	0	+	SEPHS2_tool1	98	12	98	chr14	126455928	24823440	24823526	1	86,	12,	24823440,
79	6	0	0	1	1	1	2	+	SEPN_tool1	86	0	86	chr1	169519511	18769015	18769102	2	13,72,	0,14,	18769015,18769030,
93	6	0	0	0	0	0	0	-	SEPP1a_tool1	99	0	99	chr5	135438014	32424675	32424774	1	99,	0,	32424675,
78	6	0	0	0	0	0	0	-	SEPP1b_tool1	89	5	89	chr5	135438014	32424222	32424306	1	84,	0,	32424222,
74	6	0	0	0	0	0	0	+	SEPW_tool1	96	0	80	chr16b	53486001	46899188	46899268	1	80,	0,	46899188,
90	6	0	0	0	0	0	0	+	TXNRD1_tool1	96	0	96	chr12a	94328666	77277518	77277614	1	96,	0,	77277518,
72	7	0	0	1	10	1	11	+	TXNRD2_tool1	98	3	92	chr12b	28829889	27296171	27296261	2	60,19,	3,73,	27296171,27296242,
77	12	0	0	0	0	1	1	+	TXNRD3_tool1	95	0	89	chr3	176510875	176010292	176010382	2	83,6,	0,83,	176010292,176010376,

Description of the custom SECIS track

These blat markers serve to designate key regions in non-coding downstream regions of a full set of 25 mammalian selenoproteins. The SECIS feature critical to insertion of selenocysteine at the ribosome occurs in 3' UTR. However the extent of the this region is under debate because the traditional boundaries defined by the SECISearch 2.0 web tool is too short relative to peaks in comparative genomics conservation defined by the phastCons track, yet too long for the region defined by a new Cove SECIS web tool.

Five kinds of Blat sequences marker are used to make this track. The first is simply downstream non-coding mRNA, which provides a visual context of the entire region when the browser is opened to that width. The next three markers (defined by spaces in SECISearch tool output) denote the start up to the ATGAA portion of the kink-turn, up to AA in the apical loop, and up the complementary AGAT of the kink-turn stem. The final blat marker shows output of the new Cove tool.

Overall, this custom track allows quick visual comparisons of the three main prediction schemes for the SECIS insertion element. The track synergizes with the collection and comparative genomics analysis of selenoproteins and their insertion elements at the UCSC genomeWiki project. The track configuration specified at the wiki for interactive multi-display displays actual basepair differences to be seen relative to human on all but the longest mRNA blat track

Methods for generating the data are discussed selenoprotein genomeWiki within the selenoprotein comparative genomics site.] Briefly, fully validated human representatives and placental mammal orthologous counterparts are collected and parsed with the SECIS tools to generate appropriate Blat queries. The 25 queries for each gene saturate the allowed query complexity at Blat so the psl-formatted output of 5 separate queries must be concatenated to create the input to the custom track.

The SECIS elements are validated by 6 methods: the correct position in 3' UTR, correct positive strand, occurence over a phastCons peak in the 28-species alignment, recognition by the two SECIS web tools that use the rnaFold algorithm, and agreement with experimental results for individual genesat PubMed when available..

Credits for the thousands of individuals involved in producing the underlying data for UCSC browser, each of the tracks used here, and the genomeWiki infrastructure are provided on that site.. Individual contributions to the selenoprotein pages including this custom track in the community-collaborative genomeWiki are specified at its update blog.

References:

"SECIS" provides an effective keyword search at PubMed. Each of the 166 literature references has contributed to our understanding of selenocysteine insertion. The bibiliographies of those papers, especially very recent ones, provide comprehensive coverage of selenocysteine insertion elements.

1. Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, Rosenbloom K, Clawson H, Spieth J, Hillier LW, Richards S, et al. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome Res. 2005 Aug;15(8):1034-50.

2. Kryukov, G. V., Castellano, S., Novoselov, S. V., Lobanov, A. V., Zehtab, O., Guigo R, Gladyshev, V. N. Characterization of mammalian selenoproteomes (2003) Science, 300, 1439-1443. [full text]

3. Wilm A, Linnenbrink K, Steger G. ConStruct: Improved construction of RNA consensus structures. BMC Bioinformatics. 2008 Apr 28;9:219. [full text]

4. Castellano S, Gladyshev VN, Guigó R, Berry MJ. SelenoDB 1.0 : a database of selenoprotein genes, proteins and SECIS elements. Nucleic Acids Res. 2008 Jan;36(Database issue):D332-8. [full text]

5. The Cove tool is unpublished work of Alexei Lobanov, Perry Ridge and Vadim N. Gladyshev at the Redox Biology Center, University of Nebraska, Lincoln.

6. The genomeWiki site is provided and maintained by Hiram Clawson of UCSC. Content for the comparative genomics category including the selenoprotein section is provided by Tom Pringle of the Sperling Foundation and the biomedical research community at large.